Imagine you are performing another transformation experiment and need to transfer 250 µL of LB into an Eppendorf tube. How would you perform this step? O You could use either a P200 or P1000 pipette; you would set the P200 to read 250 and the P1000 to read 25. O You would use a P200 pipette set to 250 O You would use a P1000 pipette set to 250 O You could use either a P200 or P1000 pipette; you would set the P200 to read 25 and the P1000 to read 250.
Q: O Variolation had high infectious (10%) and death rates (up to 3%). Vaccination was much safer and…
A: INTRODUCTION Variolation was an old method used for immunize infected persons against some deadly…
Q: The annual flu shot is composed of either live attenuated influenza virus or influenza subunits (the…
A: The shots of flu can be given in several forms, such as: Needle-free vaccine. Nasal spray. High…
Q: What is the other pathway of antigen processing? What is the advantage of having two distinct…
A: Antigen processing, also known as the cytosolic pathway, is an immune mechanism which prepares…
Q: The activation of a CD8-positive T lymphocyte requires presentation of antigen in association with…
A: CD8 positive T-cells are the cytotoxic T-cells of immune system which get activated when specific…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: Question:- In terms of nerve action, describe 4 different molecular components involved. And for…
A: Movement of action potential along a nerve fiber in response to a stimuli is known as nerve action…
Q: meiosis
A:
Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…
A:
Q: Analysis of DNA sequences for a particular locus among individuals within a population provides…
A: The order of the four basic building units that make up the DNA molecule - known as "bases" - is…
Q: Under certain abnormal conditions, one type of epithelial tissue may undergo transformation into…
A: Introduction The epithelium is a type of body tissue which is consists of cells that form membranes,…
Q: Single strand invasion is promoted by Rad51 protein in Eukaryotes for repair of Double Strand…
A: Homologous recombination is the exchange of genetic material between two strands of DNA. It occurs…
Q: Describe the most significant hormones responsible for sex differentiation. List the most important…
A:
Q: What will the K limited population size of this coyote population be at the next time step (2023) if…
A: After the population gets doubled, there is a check to the population because of limiting factors.
Q: Which group of animals have endoskeletons? Annelids and Mollusca Cnidaria and Ctenophora O Nematoda…
A: Endoskeleton is internal bone or cartilage structure of animals which have a vertebra and some…
Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…
A: The guinea pig, also known as the domestic guinea pig, is a rodent species in the Caviidae family.…
Q: Discuss the principles and applications of Laser-Doppler Anemometer to Agricultural and Biosystems…
A: Laser-Doppler anemometers (LDAs) are non-intrusive optical instruments that can be used to measure…
Q: Proof-reading during DNA replication refers to: * O removal of thymine dimers by by excision repair…
A: DNA polymerases are the enzymes that build DNA in cells. During DNA replication (copying), most DNA…
Q: What kind of evidence would indicate that the ability to taste PTC is inherited? Why was it…
A: 1. The ability to taste PTC shows a dominant pattern of inheritance. A single copy of a tasting…
Q: What is RNA sequencing ?
A: Most living organisms that are well-staed to define as they have DNA as their genetic material. It…
Q: In the garden pea, yellow pods (yp) are recessive to green pods (Yp) and straight tendrils (ct) is…
A: Given that, a plant with yellow colored pods and straight tendrils was crossed to a plant with green…
Q: Name the guidelines for naming of organisms?
A: Introduction In this question we will discuss about the guidelines for naming of organisms.
Q: Which molecules, or function groups, or complexes that may be responsible for the absorbance at 595…
A: Spectrophotometry applications are useful to measure the absorbance, reflectance, and transmission…
Q: Explain the process of genome editing ?
A: Introduction:- The genome is a cell's complete set of genetic instructions. The genome of humans is…
Q: The megaspore mother cell of an angiosperm has a diploid chromosome number of 2n=32. This megaspore…
A: The embryo sex formation in angiosperm is very interesting and unique feature that follows a…
Q: How can be Palawan bearcat commonly known as Palawan binturong or asian bearcats speciated?
A: The binturong (Arctictis binturong) is a medium-sized mammal, also known as a bearcat, of the…
Q: I1. Electrical impulses in muscle fibers are called 12. Groups of muscle fibers are that are…
A: The movement of skeleton muscles is voluntary in nature and regulated by central nervous system.…
Q: 5. fibers are strong but flexible and recoil. 6. The fluid connective tissues are and 7. The main…
A: Tissue: The Tissue is a group of cells that have similar structure and that function together as a…
Q: Which of the following is true about Liebig's Law of the Minimum? A. The growth of a plant is not…
A: Justus von Liebig popularised Liebig's law of the minimum, also known as Liebig's law or the law of…
Q: Complement can enhance phadocytosis because of the presence on macrophages and neutrophils of…
A: The correct option is C3b.
Q: Discuss the eukaryotic transcription process and mention the enzymes and components needed in the…
A: Cell is the basic structural and functional unit of life. All cells contains nucleus within which…
Q: Replication of DNA requires a primer to initiate DNA synthesis because DNA polymerase can add new…
A: DNA replication is the process by which new DNA is produced from the old DNA in the…
Q: mechanisms of locomotion that this organism can have?
A: 1.They move by using their muscles to push their scales against the ground
Q: all of the following that are true regarding viruses? Oncogenic viruses stimulate uncontrolled host…
A: All that are true regarding viruses - Answer - 1. Oncogenic viruses stimulate uncontrolled host…
Q: A young lady requested pre-marital genetic counselling because her sister had died in infancy of…
A: Gangliosidosis refers to a group of lipid storage illnesses caused by the buildup of lipids called…
Q: What is a double-stranded DNA molecule ?
A: DNA also known as Deoxyribonucleic Acid is a macromolecule(Nucleic acid). It is found in the nucleus…
Q: viral and human transcription is different. What molecule is used as a template strand for the viral…
A: Transcription is the process of making RNA copy of a gene sequence. It takes place in nucleus.
Q: Which series is arranged in order from largest to smallest? Chromosomes, nucleus, cell, DNA,…
A: Introduction The cell is the smallest unit that can live on its own and that makes up all living…
Q: One type of epithelial tissue can convert into another under certain abnormal conditions. Give two…
A: Introduction :- The epithelium is a type of body tissue that forms the covering on all of your…
Q: RNA molecules differ from DNA molecules in that they * a. are single stranded rather double…
A: Codon is a sequence of three DNA or RNA nucleotides. Codons encode the amino acids which eventually…
Q: Independent assortment means that: the segregation of one gene pair occurs as if no other gene…
A: The law of independent assortment states that the alleles of different genes are inherited…
Q: Construct a schematic representation of the circulatory designs of the mentioned vertebrates which…
A: Here I will provide you schematic representations of snakes, birds, fish, frog, mammals and…
Q: PROCEDURE 1 Time to Trace! In this procedure, you will be tracing two invaders: bacteria in the…
A: Bacteria are microscopic, single-celled organisms that exist in their millions, in every…
Q: Why is mutation important to evolution if it is the microevolutionary force that generally has the…
A: Microevolution is the evolution that acts on a small population or in a single species and it is…
Q: a. b. What constitutes the protein-coding region of a mature mRNA molecule?
A: INTRODUCTION The process of copying a segment of DNA into mRNA known as transcription. In the DNA…
Q: we read that in tumor cells Rb protein is hyperphosphorylated. In response to that, will p53 level…
A: Phosphorylation leads to interdomain locking, which alters the structure of pRb and inhibits it from…
Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…
A: Lowest weight = 5 lbHighest weight = 29 lbWeight difference = 24 lb 3/768 = 1/256 Four genes each…
Q: Monarch butterflies are a foul-tasting, poisonous species of butterfly. Monarchs feed almost…
A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…
Q: DNA polymerase delta has Pril subunit that can generate RNA primers True false
A: DNA polymerase alpha is the eukaryotic polymerase associated with primase activity.
Q: Which microevolutionary force typically changes genotype frequencies without changing allele…
A: The allele frequency shows the incidence of an allele or a gene variant in a population. Genotype…
Q: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Please help me out with the answer ASAP
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Fluorescence confocal microscopy (FCM) - STK38 monoclonal antibody (M01), clone 2G8- 1F3. a. b. 200 μm What is the basic principle of image formation using this microscopy technique? What can be observed and concluded from the image of the specimen?Which of the following plates could represent the results of the transformation experiment with PGLO when plated on LB/Amp, if the experiment was successful? Refer to the letters on top of the image. Ignore the letters at the bottom. A B OB O none of the choices are correctWhy are DNA samples that are to be separated by gel electrophoresis always loaded at the cathode end of the power source? The sequencer in this lab experiment using a thin capillary tube to perform gel electrophoresis. Explain how this accomplishes the same task as traditional flatbed electrophoresis.
- You now redo the experiment but instead of an SDS gel you run a native gel followed by completing the westernblot. Why did you run a native gel? What parameter are you interested in here?why does a GC rich (70-80%) and GC poor (30-40%) give a low read coverage?During incubation, prepare dilutions of the standard antiserum which constitutes the standard curve for the assay (concentration in ng/mL). Add 500 µL of PBS-milk to the supplied microtube containing 500 µL of standard antiserum to obtain Standard 1 [500 ng/mL]. Identify seven microtubes for standards 2 to 7 and place 500 µL of PBS-milk in each. Calculate how much of antiserum is used in each standard ?
- A plaque assay is performed beginning with 1 mL of a solution containing bacteriophages. This solution is serially diluted 3 times by combining 0.1 mL of each sequential dilution with 9.9 mL of liquid medium. Then 0.1 mL of the final dilution is plated in the plaque assay and yields 12 plaques.What is the initial density of bacteriophages in the original 1 mL? Enter your answer to two significant figures ( for example: 1.1 * 10^2)In a protocol for DNA sample preparation for agarose gel electrophoresis, what volume of 4X loading buffer must be added to 21 micro L of DNA to obtain a 1X buffer solution?Calculate the scan time for a GRE with TR = 30 msec, NEX = 2, Ny = 256, for (a) a single slice and (b) 15 slices.
- AsapLabel the NMR and tell what each peak representsWe discussed various assay attributes in class which provide insight into the effectiveness or suitability of a given analytical method. As part of assay development, various attributes were investigated. For each description below, indicate which assay attribute was being evaluated (partial list of attributes include precision, accuracy, specificity, linearity, LOQ/LOD, etc.). The impact of assay temperature and pH on assay results were evaluated to find a suitable range of conditions for the activity assay. Various known concentrations of standard α-AM solutions were evaluated, and the proportionality of the responses were determined. A reference standard of known α-AM (alpha-amylase) concentration was evaluated in triplicate to determine the variability (or scatter) of repeat measurements. Spiked standard of known specific activity and purity was spiked into a sample and the ability for the assay to measure the true biological activity was determined. The impact of various extract…