If you could replace all of the plant ATP synthase with ATP synthase enzymes from animal cells, oriented such that the Fo complex was in the thylakoid membrane with the open channel facing the thylakold space, and the F1 complex was present in the strama, how would this affect the ability of photosystem II to generate ATP? Assume that the animal cell ATP synthase functions normally in the chloroplast after replacement.
Q: What can you observe when you view a Gram stained-mixture of bacterial specimen?
A: Gram-staining is a technique that helps us to differentiate between Gram-negative and Gram-positive ...
Q: When comparing evolutionary similarities between different genes within a gene family, it is usually...
A: Genes are the basic units of inheritance in living organisms. They are passed down from parents to t...
Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser ...
A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and ...
Q: What are the stages of cellular respiration in which catabolism of sugars, glycerol, fatty acids, an...
A: Glycolysis, pyruvate oxidation, the citric acid or Krebs cycle, and oxidative phosphorylation are al...
Q: What is chimera in recombinant dna How we can make chimeric gene Is chimeric gene is related to gmo ...
A: Recombinant DNA (rDNA) is a technique for copy and pasting DNA sequences of interest using enzymes. ...
Q: Which statement is most accurate regarding genetics and the development of chronic disease (cancer, ...
A: Chronic diseases is a human health condition or disease that is persistent or otherwise long-lasting...
Q: A man in his early 30s suddenly developed weakness in hishands and neck, followed weeks later by bur...
A: Introduction A genome is consisting of transcriptionally active genes. These genes form mRNA as the...
Q: What are the types of plant geotropisms? Why do the stem and the roots present opposite geotropisms?
A: Introduction: Gravitropism ,also known as geotropism, is a coordinated process of differential growt...
Q: Branchial arches are absent in humans but not in fishes.
A: The branchial arches are embryologic structures that transform into anatomic features in adults. Th...
Q: What difference of person to have Muscular body compare to very muscular and extremely? Like three d...
A: The muscular system is in charge of the human body's mobility. Around 700 identified muscles are att...
Q: Malaika is a 30 year old African lady with a history of Schizophrenia. She is currently taking Olanz...
A: Malaika is currently taking Olanzapine 20 mg, a drug to treat Schizophrenia. Olanzapine : Olanzapine...
Q: What are the types of plant geotropisms? Why do the stem and the roots present opposite geotropisms?
A: Introduction :- Geotropism is the movement of plant components in reaction to gravity. Geotropism ca...
Q: how does an organism maintains homeostasis through the interaction of the various organ systems in t...
A: Homeostasis, from the Greek words for "same" and "steady," refers to a self-regulating process by wh...
Q: Pathogen A has an ID50 of 10 cells and an LD50 of 10,000,000 cells. Pathogen B has an ID50 of 10,000...
A: Given information Pathogen A ID50 of 10 cells LD50 of 10,000,000 cells Pathogen B ID50 of 10,000 ...
Q: Provide a description on the plant cell of the Hydrilla leaves viewed on a microscope with high powe...
A: Answer : Hydrilla is a type of aquatic plant which are the submerged in water. They functions as th...
Q: explain the significance of human nervous system in maintaining homeostasis.
A: Introduction: A complex system of nerve cells and fibres that receives and transmits signals from an...
Q: What is the climax stage of an ecological succession?
A: Introduction:- Ecological succession is the process that describes how the structure of a biological...
Q: a. What can you observe in viewing your stained bacterial slide under the microscope if you fixed a ...
A: The staining is a very important process in microbiology that is used to identify specific microorga...
Q: What is biology
A: Biology deals with living organisms and their various processes. It is a natural science discipline.
Q: what is the purpose of the nucleous ? - define diploid
A: In biology, a cell is a membrane-bound unit that holds the basic molecules of life and is made up of...
Q: 1. What is the probability of having pink flowers when pink snapdragon and white snapdragon are cros...
A: Introduction: Incomplete dominance is a form of intermediate inheritance in which one allele for a s...
Q: Answer the following: 1. Which pieces of DNA are the most informative? Why? 2. Explore the concept o...
A: The process of determining the sequence of nucleotide bases (As, Ts, Cs, and Gs) in a molecule of DN...
Q: What are cerebrovascular accidents?
A: The supply of oxygen to the brain is carried out by blood. Blood contains oxygen-carrying molecules ...
Q: All of the following can be associated with human blood type except A. Multiple alleles B. Codominan...
A: Meiosis It is the type of cell division that results in 4 daughter cells, each with half the number ...
Q: n Figure 6-6, assess the allele Vfwith respect to the Vbyallele: is it dominant? recessive? codomina...
A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity ...
Q: Match the terms with the best description.___ dihybrid cross a. bb___ monohybrid ...
A: Mendel worked on seven contrasting characters in the pea plant. Based on his findings he postulated...
Q: Vertebrates have a complete digestive system, which means that their digestive tract has two opening...
A: *All invertebrates do not have complete digestive system * The complete digestive system forms from...
Q: 2. What is the probability of having odd numbers using two die rolled at one time? A. 1/6 B. 1/3 C. ...
A: ANSWER 2) (D) 1/4 When two dice are thrown simultaneously probability of getting an odd number on bo...
Q: What is the role of the cuticle in the successful propagation of nematodes?
A: Nematodes belong to the phylum Nematoda under the Animalia kingdom. These are free living and Parasi...
Q: Which of the following biogeochemical cycles include decomposition? can select more than one answer...
A: Biogeochemical cycles are the chemical cycles that maintain the availability of nutrients in the env...
Q: Most of the feathers of erminette fowl are light colored, with an occasional black one, giving a fle...
A: Gregor Johann Mendel is usually defined as the way that they are been regarded as the father of gene...
Q: Q:-What is a xaxim?
A: Introduction In this question we have to discuss about the xaxim.
Q: The TCA cycle is an example of __________. ○ catabolism ○ anabolism ○ lithotrophy ○ autotrophy
A: The sum total of all the reactions that take place inside the body is called as metabolism. This met...
Q: . In a certain plant, the flower petals are normally purple.Two recessive mutations arise in separat...
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...
Q: Why are EMBRYOS so useful when comparing phylogenic relationships?
A: The majority of these similarities occur during embryonic development. Pharyngeal slits, which devel...
Q: Q:-What is neoplasia?
A: Introduction In this question we will discuss about the Neoplasia.
Q: Joshua Tree National Park hosts several species, including the cactus wren, creosote bush, kangaroo ...
A: Ecological levels of organizations are as follows :-
Q: Which temperature is Taq polymerase's optimal temperature O 20 degrees C 72 degrees C 55 degrees C O...
A:
Q: define a single nucleotide polymorphism
A: Introduction:- Genetic polymorphism is the inheritance of a trait controlled by a single genetic loc...
Q: Explain the relationship between photosynthesis and respiration in the cycling of chemicals and flow...
A: Metabolic activity or process are the process taken place inside an organism in which energy is eith...
Q: Q6.10. For a population containing 80 females and 20 males, what is the effective population size, N...
A: Introduction:- One of the most significant parameters in population genetics and conservation biolog...
Q: MOLECULAR CLONING • Molecular cloning is the laboratory process used to create recombinant DNA. • It...
A: Recombinant DNA: it is a method of combining two distinct DNA (molecule) sequences, which may or may...
Q: What analysis is provided by the study of human age pyramids?
A: Introduction In this question we have to write about the analysis provided by the study of human age...
Q: In which nations is grazing land being used sustainably? In which nations is forest land being used ...
A: The long-term availability of a raw material that is either renewable or nonrenewable is referred to...
Q: How do populations of predators and prey vary in predatism
A:
Q: Describe how hair cells work in general, and in the fish lateral line system.
A: Lateral line system It is a type of sensory system found in fishes and aquatic amphibians. This sys...
Q: A glass spreader can be sterilized by dipping in 70 % ethanol and burning of excess False .a True .b
A: Introduction:- Spreaders, also known as cell spreaders, are laboratory instruments that allow sample...
Q: Do individual organisms survive exposure to a toxic chemical because they are “mutated” by the chemi...
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: Heterozygous individuals perpetuate some alleles that have lethal effects in homozygous individuals....
A: The term "lethal gene" refers to a gene that causes an individual's death. In nature, these genes mi...
Q: Discussion on the challenges using the technology by touching the followings: • Technology challenge...
A: Diabetes It is a disease that is caused when the blood glucose level becomes too high. Blood glucose...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Identify the chemical basis for ApH and AY across the chloroplast thylakoid membrane by dragging the descriptions to their targets. Be sure to notice that the upper arrow iindicates ApH and the lower arrow indicates ΔΨ. ATP synthase complex H+ N ADP + P₁ Light energy ATP H*N Photosystem I/II- Chloroplast N side Aus PN ApH T + Thylakoid membrane HTp H+p Lumen Stroma P side Proton circuit A B High H concentration Low positive charge High positive charge Low H+ concentration Within the image, identify the types of proton translocation by dragging each label to its target. O XH₂ 2H+ + Z 2 H* ZH₂ O XH₂ Z 2H+ ZH₂ 2H+ C A B Proton pump Redox loopMelvin Calvin and Andrew Benson determined the steps in the light-independent reactions of photosynthesis by exposing the green alga Chlorella to CO2 labeled with the radioisotope carbon 14. By looking at which compounds the C14 ended up in, they were able to identify all intermediates in this cyclic pathway. Why did they predict correctly that the same set of intermediates would be formed in the light reaction in land plants?Provide a simplified schematic presentation of (non-cyclic) photophosphorylation. Clearly indicate the location and direction of electron and proton flow as well as organelle compartments. (You can also draw the Z-scheme but then you have to include ADP phosphorylation).
- For most plants, two distinct photosystems (Photosystem I and Photosystem II) work together in series during photosynthesis. These photosystems are complexes of proteins and pigment molecules. Statement 1: Photosystem I has an absorption maximum of 680 nm, whereas Photosystem II has an absorption maximum of 700 nm. Statement 2: The special pair of chlorophyll a molecules in the reaction center of photosystem I is designated as P700, whereas the special pair of chlorophyll a molecules in the reaction center of photosystem II is designated as P680. Statement 1 is true. Statement 2 is false. Statement 1 is false. Statement 2 is true. Both statements are true. Both statements are false.There are two photosystems involved in the light reaction of photosynthesis. Both take upenergy from the sun in the form of light.A. Where are the photosystems located and what is the name of the organelle? B. Where does the energy that the photosystems take up, go? Describe for eachphotosystem WHERE the energy ends up at the end of the light reactions. In otherwords, what products contain the energy from which photosystem at the end ofthe light reaction?You performed an experiment on photosynthesis on Elodea, using bromothymol blue as an indicator forpH. Your two light conditions were red light and blue light. You found that in blue light, your solutionturned a nice cobalt blue, and in red light it turned green.a. What can you conclude about the efficiency of photosynthesis in Elodea regarding those twowavelengths?b. What would your conclusion be if your negative control (no Elodea in white light) turned greenalso?
- In cyclic photophosphorylation, it is estimated that two electrons must be passed through the cycle to pump enough protons to gener- ate one ATP. Assuming that the AG for hydrolysis of ATP under con- ditions existing in the chloroplast is about –50 kJ/mol, what is the corresponding percent efficiency of cyclic photophosphorylation, using light of 700 nm?When running cycle photophosphorylation and passaging electrons from PSI to two fully reduced PQH2s, how many photons would be necessary for the electrons to complete one cycle?Calculate (in kJ/mol) the energy that is required by the Rhodopseudomonas viridis photophosphorylation system to synthesize 3 ATP? (Assume that the R. viridis F1F-ATP synthase c-subunit rotor contains 12 c-subunits and that the R. viridis cytochrome b/c complex translocates 2 H/e". Also assume that the wavelength of lig! is 680 nm.) Number of photons required to synthesize 3 ATP = photons Energy = kJ/mol
- Thylakoids were isolated from chloroplasts and incubated in the dark in an acidic solution (pH 4) to equilibrate the pH. After 30 minutes, the thylakoids were transferred to a basic solution (pH 8) and kept in the dark. Will this system produce ATP? Explain. Will this system produce G3P? Explain.W hen a culture of Chlamydomonas is exposed to HIGH intensity light, the cells will display negative phototaxis and move away from the light. Which of the following could act as a cellular signal triggering movement away from the light? A. Low levels of P700+ relative to P700 in the chloroplast. B. High levels of G3P in the cytosol. C. High levels of NAD+ relative to NADH in mitochondria. D. Low levels of ATP relative to ADP in the cytosol.For the following questions, choose one to discuss: chloroplast/photosynthesis State at the outset which one you will discuss. A) What role do proton gradients play in the process of photosynthesis proton gradients allow B) Where are proton gradients formed? Within what structures are they seen in chloroplasts How do the structures help them to maintain a gradient? C) Explain where and how the chloroplast or mitochondria uses passive transport and active transport to complete photosynthesis or cellular respiration.