Identify each of the amino acid in the polypeptide and then name it using the 3-letter abbreviations.

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Mutation in a gene sequence causes encoding of a mutated protein. This mutated protein will have…

Q: Write down the amino acid sequence of the tripeptide shown below. CH3 H H₂N NH -NH,

A: The above given figure is of a tripeptide. Since we know that an amino acid sequence begins with…

Q: orrect nomenclature of the polypeptide:

A: A single linear chain of many amino acids held together by amide bonds is known as a polypeptide.…

Q: what is the amino acid squence of the protein?

A: Amino acids are organic compounds that serve as the building blocks of proteins. They play a crucial…

Q: Name the following nucleotide: HN P-0-P-0-CH2 OH

A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…

Q: are nitrogen bases with two rings.

A: Nitrogen bases are an integral part of a nucleotide from which the DNA is made. Apart from nitrogen…

Q: What is the first amino acid in the polypeptide?

A: The process of synthesis of the protein by the mRNA is known as Translation.

Q: Chemical formula of Nucleotides

A: The nucleic acids are formed from monomers called nucleotides. There are four nucleotides in DNA,…

Q: H,Ñ-CH-C–NH-CH-C-NH-CH-C-0 CH, CH-CH; СНОН CH, ČH; ČH;

A: The given peptide is composed of three amino acids; it can also be called tripeptide. The sequence…

Q: Identify the amino acid (s) present in this structure.

A: The given molecule is a dipeptide i.e. it is composed of 2 amino acids bonded via a peptide bond.…

Q: Draw the following trinucleotide: pGAU

A: A nucleotide is composed of a nitrogen base, a pentose sugar and a phosphate group. A trinucleotide…

Q: This is the three-letter code for the amino acid that is the most geometrically constricted amino…

A: Amino Acids are the organic compounds that combine to form proteins, hence they are referred to as…

Q: (a) Identify the base and monosaccharide in the following nucleotide. (b) Give the name and three-…

A: Nucleotides are the building blocks of nucleic acids which are the organic molecules that are…

Q: I was given an amino acid position 564 with the PDC code 2V1X. Would it be possible to describe why…

A: A mutation is a change in the DNA sequence of an organism. Mutations can be caused by errors in DNA…

Q: Which amino acids are in the figure?

A: Amino acids are the building blocks of proteins. They are organic compounds made up of an amino…

Q: Write the name as one word, again using the prefix di- because there are two methyl groups.

A: The prefix is the word or number which are added before dictating the number of elements present in…

Q: Lysozyme is a      Lipid     Carbohydrate     Protein     Nucleotide

A: Lysozyme is an enzyme that catalyses the hydrolysis of β-1,4-glycosidic linkages. Hydrolysis means…

Q: There are several sugars along with fructose and glucose that are isomeric, name them

A: The question asked for a list of sugars that are isomeric to fructose and glucose. Isomers are…

Q: Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…

A: Translation is a biological process that converts a nucleotide sequence into an amino acid sequence.…

Q: How many amino acids are in the following peptide? H₂N H3C ZI CH3 IZ O=C CH3 `N H HH OH | LOH

A: A polypeptide chain constitutes of amino acids are linked together via peptide bonds. The proteins…

Q: Amino acid +Amino acid >Dipeptide +______

A: Proteins are macromolecules composed of monomeric units called amino acids. These amino acids are…

Q: _____________ are short nucleic acid segments containing 50 nucleotides or less.

A: Primer Oligonucleotides are nucleic acid segments containing 20-30 nucleotides

Q: HO NH2 H. ZI

A: Amino acids are organic compounds that consist of an alpha-amino group, a carboxy group, and an R…

Q: Define polysaccharide

A: Introduction: A carbohydrate is a molecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms…

Q: What is the GLOBULAR PROTEIN as the classification of proteins based on shape or conformation

A: The macromolecules formed of amino acids linked by peptide bonds are called proteins. They are…

Q: Thymine is a nitrogenous base or nucleosides?

A: The primary structure of a protein is encoded in the sequence of a nucleic acid. The nucleic acid is…

Q: How do you translate this into amino acid sequence

A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…

Q: How many nucleotides code for one amino acid

A: INTRODUCTION Amino acid These are molecules that combines to form protein.

Q: are small proteins produced by cells infected with a virus, and sometimes can be used in viral…

A: If a person is virally infected, the infected cells starts to produce small proteins known as…

Q: What is the acid-base property of amino acids? Please do not plagiarize from the internet and…

A: Amino acids are the constituents of protein molecules. As the amino acids in their basic structure…

Q: figured out that the protein sequence was:   Met-Ala-Arg-Gly-Trp-Ala-Pro   Work backwards…

A: In this process first of all RNA sequence could be find out by the genetic code. Later on  sequences…

Q: What does it mean for an amino acid to be polar? Please explain what qualities about an amino acid…

A: Proteins are folded polypeptides. A polypeptide is a polymer of amino acid residues linked via a…

Q: Which amino acid is NOT associated with the oligopeptide given by the shorthand notation GRFAV?…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: A,

A: Meosis is the type of cell division which resukts in the formation of the gamete.  In humans the…

Q: what is the correct way of drawing a peptide backbone?

A: A peptide is a polymer of amino acids. In a peptide, 2 amino acids are linked to each other via a…

Q: How do the "R" groups of amino acids contribute to the 3-D shape?

A: The R-groups of amino acids, also known as the side chain, confer various chemical properties to…

Q: Create protein sequence with 10 amino acids

A: A protein is a polymer of amino acids.  Two amino acids are joined together by forming a peptide…

Q: Which is the amino acid represented below? I H₂N O OH

A: The building components of protein are amino acids. Long strands of amino acids make up proteins.…

Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…

A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…