I have complete the table that required. Indicate which mutations were success why some were not from the size about. indicate at what stage any of the mutagenesis failed. Here are the list of forward and reverse primers for the genes of interest (genes that we wanted tomutate) and for the kanamycin gene (the gene was wanted to replace them with).On Moodle you will find the gene sequence for all the gene below.Task 2: Find where the primers bind to in the gene sequences on Moodle (kan has beenprovided for you as a reference)GeneSize ofgene (bp)Expected size ofPCR product (bp)lacZ3075304fliE315255rpoA990420nagC1221GCTCAGAACGTACCACCG3291041ompA731GCCGGGATACCTTTGGlexA609GTTCGACTTTATTGCCCTG350kan cassette 816CCTGGTATCGGTCTGCGGAAGCCCGATGCGCCAGAG549tet casette 1148CTATAAACCGCACTGTGAGTCCTGGATTCCTCAGGT265The reverse primer is the reverse compliment - remember to reverse compliment when looking for it in the sequences. Kan has beencompleted for youForward Primer5' to 3'GTTAACCGTCACGAGCATCACAGGGGATTGAAGGGGTTAReverse primer5' to 3'CGTTCAGGAAGATATCCCGCTGCCAACGCTGCGGCCCGACCCATGAAAACGGCACGCAAAGGCGTTATTGAMICROBIALPHYSIOLOGY ANDGENETICS ITGATCACACTCGGGTGATTACCGCACCTGAATCCCCATTTGCGGATCGATTGTGCCGTTGGTTT nagC primersM L1 L2 L3 L4|||||||||||||lacZ primersM L1 L2 L3 L4fliE primersM L1 L2 L3 L4IompA primersM L1 L2 L3 L4|||||||||||||tet primersM L1 L2 L3 L4kan primersM L1 L2 L3 L4kan primersM L1 L2 L3 L4kan primersM L1 L2 L3 L4bp-10,000-8,000-6,000-5,000-4,000-3,000-2,500-2,000-1,500-1,000-750-500-250, 2531.2% agarosekI=

Name: I have complete the table that required. Indicate which mutations were
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: I have complete the table that required. Indicate which mutations were success why some were not from the size about. indicate at what stage any of the mutagenesis failed. Here are the list of forward and reverse primers for the genes of interest (ge