Homework Help is Here – Start Your Trial Now!
Science
Biology
Human growth hormone (hGH) activates expression of the PIND gene in NIH3T3 cells by inducing binding of a transcription factor to the promoter region between -385 and -178 base pairs upstream of the transcription start point. To find the exact binding site of the transcription factor an in vivo footprinting experiment is done with DMS, a chemical compound that will enter the cells and cut the DNA at G residues if no transcription factor is bound to the residue. N C hGH Figure 3.1 In vivo footprint of the PIND gene promoter. The DNA sequence is shown next to the footprint. Lane N is a footprint of “naked" DNA. (Purified DNA with no bound proteins). Lane C is a footprint of NIH3T3 cells that do not express PIND. Lane hGH is a footprint of NIH3T3 cells treated with human growth hormone that induces expression of PIND. 1. Why are some bands missing in lane hGH but not in the two other lanes? || || | || SATACGGAAGGTTGCTGCTGTTGTATGGCT

Human growth hormone (hGH) activates expression of the PIND gene in NIH3T3 cells by inducing binding of a transcription factor to the promoter region between -385 and -178 base pairs upstream of the transcription start point. To find the exact binding site of the transcription factor an in vivo footprinting experiment is done with DMS, a chemical compound that will enter the cells and cut the DNA at G residues if no transcription factor is bound to the residue. N C hGH Figure 3.1 In vivo footprint of the PIND gene promoter. The DNA sequence is shown next to the footprint. Lane N is a footprint of “naked" DNA. (Purified DNA with no bound proteins). Lane C is a footprint of NIH3T3 cells that do not express PIND. Lane hGH is a footprint of NIH3T3 cells treated with human growth hormone that induces expression of PIND. 1. Why are some bands missing in lane hGH but not in the two other lanes? || || | || SATACGGAAGGTTGCTGCTGTTGTATGGCT

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

please help. do 1st problem

Human growth hormone (hGH) activates expression of the PIND gene in NIH3T3 cells by inducing binding of a transcription factor to the promoter region between -385 and -178 base pairs upstream of the transcription start point. To find the exact binding site of the transcription factor an in vivo footprinting experiment is done with DMS, a chemical compound that will enter the cells and cut the DNA at G residues if no transcription factor is bound to the residue. N C hGH Figure 3.1 In vivo footprint of the PIND gene promoter. The DNA sequence is shown next to the footprint. Lane N is a footprint of “naked" DNA. (Purified DNA with no bound proteins). Lane C is a footprint of NIH3T3 cells that do not express PIND. Lane hGH is a footprint of NIH3T3 cells treated with human growth hormone that induces expression of PIND. 1. Why are some bands missing in lane hGH but not in the two other lanes? 2. In how many places does the transcription factor bind to the promoter? 3. What is the sequence of the most likely binding site for the transcription factor in the PIND promoter? ||| || || TGGTGTGTGGAAGGAGATAGAGTGAGATACGGAAGGTTGCTGCTGTTGTATGGCT
Transcribed Image Text:Human growth hormone (hGH) activates expression of the PIND gene in NIH3T3 cells by inducing binding of a transcription factor to the promoter region between -385 and -178 base pairs upstream of the transcription start point. To find the exact binding site of the transcription factor an in vivo footprinting experiment is done with DMS, a chemical compound that will enter the cells and cut the DNA at G residues if no transcription factor is bound to the residue. N C hGH Figure 3.1 In vivo footprint of the PIND gene promoter. The DNA sequence is shown next to the footprint. Lane N is a footprint of “naked" DNA. (Purified DNA with no bound proteins). Lane C is a footprint of NIH3T3 cells that do not express PIND. Lane hGH is a footprint of NIH3T3 cells treated with human growth hormone that induces expression of PIND. 1. Why are some bands missing in lane hGH but not in the two other lanes? 2. In how many places does the transcription factor bind to the promoter? 3. What is the sequence of the most likely binding site for the transcription factor in the PIND promoter? ||| || || TGGTGTGTGGAAGGAGATAGAGTGAGATACGGAAGGTTGCTGCTGTTGTATGGCT
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 3 steps with 2 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Immune disorders
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS