Answered: How many components are there in RNA…

Name: . How many components are there in RNA polymerase of prokaryotes? List
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: . How many components are there in RNA polymerase of prokaryotes? List down the functions of each component.

Science

Biochemistry

How many components are there in RNA polymerase of prokaryotes? List down the functions of each component.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 11QP: Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA

See similar textbooks

Related questions

Q: Is DNA synthesis likely to be faster in prokaryotes or in eukaryotes?

A: DNA synthesis is the process in which replication of DNA occurs in the S phase of the cell cycle.…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide…

Q: The following picture drawing represents co-translation in E. coli. Answer the questions: A. Which…

A: Using the signal recognition particle (SRP), the co-translational route transports secretory…

Q: What are two major similarities between protein synthesis in bacteria and in eukaryotes? What are…

A: DNA is the carrier of genetic material in almost all living organisms except a few RNA viruses. DNA…

Q: The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was…

A: The synthesis of RNA (ribonucleic acid) from DNA (deoxyribonucleic acid) by the enzyme RNApolymerase…

Q: Consider the following tRNAs, where the numbered forms represent the amino acids associated with…

A: Transcription is the process in which mRNA (messenger RNA ) is made from DNA which further…

Q: Determine whether each event occurs during initiation, elongation, or termination. Initiation…

A: During translation, ribosomes move along the mRNA strand, reading the genetic code and using it to…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid whereas…

Q: ) How is the lagging strand made in DNA replication? Include important enzymes and structures.…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA…

A: Translation is the process of synthesis of protein from mRNA . So , RNA serves as a template . But ,…

Q: Which of these molecules has multiple partial charges and thus is most soluble in water? H H HHHH…

A: Most soluble in water.

Q: Which of the following statements is correct? The prokaryotic ribosomal RNAs are 18S, 23S, and 28S…

A: The objective of the question is to identify the correct statement about ribosomal RNAs and…

Q: You are studying a new inhibitor that you know prevents proper formation of ribosomes by binding to,…

A: Let's break down the explanation further and provide an example to illustrate the concept: RNA…

Q: Outline the function of each of the subunits of E.coli RNA polymerase.

A: The bacterial RNA polymerase is responsible for the transcription of genes present on DNA by…

Q: Explain the most important concept of RNAi ?

A: A "nucleic acid" is a nucleotide-based linear polymer that is part of the cell's information…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: DNA is a double stranded helical structure composed of a template and coding strands. Template…

Q: Can someone please draw a diagram to explain transcription and translation and difference in…

A: Transcription is the process in which RNA is synthesized with the help of RNA polymerase enzyme.…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

. How many components are there in RNA polymerase of prokaryotes? List down the functions of each component.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Components of RNA polymerase

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water Photophosphorylation
At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. mRNA in eukaryotes, can exist outside the nucleus acts as an enzyme for peptide synthesis composed of ribonucleic acid rRNA Answer Bank moves amino acids to the site of protein synthesis tRNA contains nucleotide triplets that code for specific amino acids has a convoluted structure with a three-base sequence called an anticodon moves genetic information out of the nucleus and into the cytoplasm mRNA, rRNA, and tRNA
Consider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense strand, Give the correct nucleotide sequence of the RNA produced after transcription. If the RNA formed in #1 is already a functional mRNA and will be used to synthesize proteins, how many codons are present here that will actually code for amino acids? What is the sequence of the stop codon in this mRNA? What is the sequence of the 3rd codon in this mRNA? What is the sequence of the last codon in this mRNA that actually code for an amino acid?
Sketch a typical cloverleaf structure for transfer RNA. Point out any similarities between the cloverleaf pattern and the proposed structures of ribosomal RNA.
. What is the biological benefit of a degenerate genetic code?
Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it seem like a waste of cellular energy to make such a large structure so that translation can occur?
What is the difference between eukaryotes and prokaryotes in terms of RNA polymerase?
Explain in detail the process of translation (initiation, elongation, and termination) in prokaryotes and eurkaryotes. Provide diagrams for full processes please!
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
Identify whether each of the following descriptions applies to typical prokaryotic genomes only, typical eukaryotic genomes only, both, or neither, according to lecture. Answer options may be used more than once or not at all. Composed of double-stranded DNA only. Each chromosome has a centromere. Species with larger genomes have more genes. [Choose ] [Choose ] prokaryotes only neither eukaryotes or prokaryotes eukaryotes only both prokaryotes and eukaryotes [Choose ]
In bacterial genes, as soon as any partial mRNA transcript is produced by the RNA polymerase system, the ribosome assembles on it and starts translating. Draw a diagram of this process, identifying 5′ and 3′ ends of mRNA, the COOH and NH2 ends of the protein, the RNA polymerase, and at least one ribosome. Why couldn’t this system work in eukaryotes?
You are studying a new inhibitor that you know prevents proper formation of ribosomes by binding to, and inhibiting, one of the eukaryotic RNA polymerases. Which polymerase(s) could it potentially be binding to and why would that prevent proper ribosome formation?