GK 4 G 2 1 2 3 4 5 6 7 8 N Bits

Q: Write down the abbreviations (both 1 letter and 3 letter) for the amino acids given below:…

A: Amino acids contain an alpha-carboxylic acid group and an alpha-amino group. Glycine is the simplest…

Q: The chain 3 subunit contains the amino acid sequence shown below. This sequence contains one alpha…

A: An alpha-helix is defined as a repetitive structure having a spiral structure. Alpha-helix is a type…

Q: Leni, Isko and Ping are trying to determine the molecular weight of their crude protein samples…

A: SDS-PAGE (sodium dodecyl sulphate–polyacrylamide gel electrophoresis), is a discontinuous…

Q: Normal hemoglobin (HbA) leu thr glu glu lys Sickle cell hemoglobin (HbS) leu thr pro val glu lys ser…

A: Sickle cell anemia is a genetic blood disorder characterized by abnormal, crescent-shaped red blood…

Q: The given protein, Protein X, is a heterotrimer - meaning it is a multimeric protein consisting of…

A: Electrophoresis is the technique of separation of charged molecules under the influence of the…

Q: Assume a protein is composed of 120 amino acid residues and that each amino acid can have three…

A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…

Q: The structure of a peptide is showwn bélöw: NH, HN

A: Peptides of proteins are composed of 20 standard amino acids attached together via peptide bonds.…

Q: Protein folding

A: Proteins are composed of some 20 types of amino acid residues, and they would be more or less alike…

Q: As an example, consider albumin, a protein made of a single polypeptide weighing 66,000 daltons (66…

A: Gel electrophoresis if the technique of separation of molecules on the basis of their size and…

Q: A nonapeptide was treated with dithiothreitol to reduce any disulfide bridges, then partially…

A: Amino acids are the basic unit of the peptide and proteins. They are joined via the peptide bonds to…

Q: Lactose permease, a protein of E. coli, is composed of a singlepolypeptide that is 417 amino acids…

A: Translation is the process by which the protein is synthesized by reading the codons in mRNA. The…

Q: Saccharide X, a sugar composed of repeating cellobiose and maltose, is a constituent of a…

A: Plants constitute a large number of carbohydrates. Glycobiology means the study of the…

Q: Which of the following oligopeptides has net charge equal to zero? O Glutamate - Arginine -…

A: We can determine the charge on a protein by determining the number of positively charged amino acids…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Given the following information, which protein would be most difficult to isolate from protein X…

A: Salting and dialysis are the processes used to isolate proteins. Salting is a purification process…

Q: I was given an amino acid position 564 with the PDC code 2V1X. Would it be possible to describe why…

A: A mutation is a change in the DNA sequence of an organism. Mutations can be caused by errors in DNA…

Q: Draw the structure of the same tripeptide at pH 7.00.

A: The pKa values of amino acid side chains, the pKa of the alpha amino group at the N-terminus and the…

Q: You are studying the toxic protein called ectatomin, a major component of ant venom (specifically…

A: Proteins contain amino acids. They are linked to each other by peptide bonds. The amino acid such as…

Q: for the following amino acids below circle the r groups then tell me if they are polar or nonpolar

A: Contain polar side chains.Interact well with water due to the presence of polar groups like hydroxyl…

Q: Refer to the following table below to answer the succeeding questions: Amino acid pK, pK2 pK3…

A: The charge on the amino acid depends on the pKa value of the ionizing groups in the amino acid. The…

Q: 80 20 60 0 60 20

A: It is a way to visualise angles as a function of angles . It is the way we could identify the…

Q: The following data describe binding of ligand A to a protein, using both Scatchard plots and Hills…

A: Scatchard plots is used to determine the affinity of the receptor or any protein for its ligand and…

Q: Case B: An oligopeptide has the ff amino acid composition: 2 Phe, 2 Met, 2 Glu, 1 Arg, 1 Val, 1 Leu,…

A: Peptides are formed of amino acids connected through an amide/peptide bond. The peptide bond is…

Q: Consider the sequences (i-iv) that represent sections of a protein. i) -AEEAAAAMAAAAMAAY ii)…

A: Secondary structure is the formation of regular patterns through interaction between nearby…

Q: You are working in the lab with a polypeptide that is present in solution at 1 mg/mL. The…

A: Molarity (M) is the amount of a substance in a certain volume of solution. Molarity is defined as…

Q: Electrophoresis is performed at PH 6.8 on a mixture of mutated hemoglobin that differ from normal…

A: To determine the order of migration between the cathode and anode of the mutated hemoglobins…

Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…

A: One gene one enzyme hypothesis, proposed by Beadle and Tatum, says that each enzyme produces a…

Q: Jacqueline isolated an interesting new protein from the broth of a yeast culture. After purification…

A: The minimum molecular weight of the isolated protein was calculated as                Residue% =…

Q: Indicate whether each of the following molecules is an alpha amino acid or not and explain why.

A: Amino acids are monomers of proteins which means amino acids make up proteins. Amino acids are…

Q: Draw a ceramide with a (16:1n-7) fatty acid attached

A: Fats are made up of fatty acid chains (acting as tails of fats) attached to either glycerol or…

Q: You could use absorbance at 280nm or colorimetric assays like the Bradford assay or bicinchoninic…

A: There are different methods present to measure the concentration of a given protein.

Q: Two proteins are discovered, and both are shown to have a potential in treating fatty liver…

A: There are few points fatty liver syndrome . These are as follows : We know that fatty liver…

Q: oligosaccharides are attached to proteins for a variety of reasons. They’re attached to the newly…

A: Macromolecules are large organic molecules composed of thousands of covalently connected atoms and…

Q: is it true that aplha and beta are made up of same amino acids but Beta chain is longer than alpha…

A: Hemoglobin (Hb) is a complex protein which is consist of two parts - the heme and the globin. Heme…

Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…

A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…

Q: A tetrameric protein dissociates into dimers when the detergent sodium dodecyl sulfate (SDS) is…

A: Proteins are polymers of amino acids linked by peptide bonds. Proteins can be single chain or more…

Q: 1. The amino acid sequence for the protein lysozyme is given below. Estimate the isoelectric point…

A: Isoelectric point is the pH where the net charge on a protein is zero.

Q: Which of the peptide sequences below best matches the hydropathy plot shown? 1. ILYYAGSREDHSGYLIL 2.…

A: Based on the hydropathy plot shown, which has regions of both positive and negative values…