Give an example of a journal that is about genetic switches involving rna molecules. Give the author’s name the title of the study and the link to the journal

Q: you could determine if two genes are located close together on a chromosome.

A: Gene mapping is the process of identifying  the locations of genes on the chromosomes. The closer…

Q: Discuss theh type of information that genome-wide association studies can provide

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Describe the mechanisms of horizontal gene transfer in bacteria, describing the manner in which the…

A: Horizontal gene transfer, or the process of exchanging genetic material between neighboring…

Q: 5) Which mutation would NOT cause a change in an organism's phenotype?   A) TAT becomes TGT     B)…

A: The amino acids coded are decided by the sequence of the DNA, as the template strand is transcribed…

Q: The enzyme reverse transcriptase

A: The method used by an enzyme in cells to form a DNA copy from RNA. Reverse transcriptase, an enzyme…

Q: Define genomics, next - generation sequencing, and metagenomics. Create a paragraph that uses all of…

A: INTRODUCTION The genomics, next generation sequencing and metagenomics are briefly explained below.

Q: Why was the ruppy dog created or modified? Give 4 reasons

A: A cloned beagle named Ruppy – short for Ruby Puppy – is the world's first transgenic canine ( dog).…

Q: Give at least 3 examples of model organisms used to study genetics.

A: Genetic study can be done on many organism to study about specific trait,phenomenon or disease .…

Q: Review the Process Diagram, Figure 8.9, and answer this question. The type of horizontal gene…

A: Horizontal gene transfer (HGT) or lateral gene transfer is the movement of genetic material between…

Q: Explain the important differences in gene structure and expression between prokaryotes and…

A: In the world mainly two types of cells present that is eukaryotic cell and prokaryotic cells.…

Q: Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:

A: DNA is a molecule that carries genetic information. It contains instructions used in the growth,…

Q: Suppose a researcher conducts matings between three Hfr bacterial strains and an F¯ strain. The…

A: The F-plasmid in E. coli can exist as an extrachromosomal genetic element or can be integrated…

Q: True or false: bacterial cells may contain multiple genomes?

A: False

Q: How does the study of the nucleotide sequences of ribosomal RNA fit into a discussion of taxonomy?

A: Taxonomy is the scientific classification of organisms belonging to different species based on their…

Q: What are Hfr-strains? Why were they useful in the early days of bacterial genetics?

A: Horizontal gene transfer is the process of transferring genetic material from one organism to…

Q: Is there any situation in which DNA is made based on a RNA template? What is the enzyme involved?

A: DNA: Deoxyribonucleic acid is a molecule composed of two polynucleotide strands that runs along each…

Q: Compare and contrast orthologs and paralogs.

A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…

Q: Two students were debating whether viruses are living or nonliving. Student A: Viruses are living…

A: Viruses are obligate intracellular parasite. They are considered non-living entities which can able…

Q: higher mutation rates than others follow­ing exposure to UV light

A: Mutation rates in bacteria can vary depending on various factors, including exposure to external…