Frameshift mutation worksheet (continued) CTCTTCACTAATTCGGGCGGATTTCCCGAAAAAAA GAGAAGUGAUUAAGCCCGCCUAAAGGGCUUUUUUU GLU LYS 5' DNA 3' RNA protein 3' RNA protein 3' RNA protein 3' RNA protein 3' RNA protein

Based on the first paper with the tables, fill out the second worksheet.

Search (Option + Q) Review View Help Editing v B IU ev Av A =<而< 面 三< A Question 16 The full set of different transcripts expressed by a cell is called Proteome Genome Transcriptome Glycome Question 17 One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is allows quantification of transcripts over five orders of magnitude usei to identify new transcripts and alternative isoforms RNA-Seq is sensitive and offers a way of profiling transcripts of single cells a significant amount of input RNA is required Question 18 Which of these statements are not true for the DNA libraries: Genomic DNA libraries are collection of cloned DNA fragments representing the genome from an organism. Genomic DNA is completely (fully) digested with restriction endonuclease. Complementary DNA (CDNA) libraries are derived from reverse transcribed RNA Genomic DNA is partially digested with restriction endonuclease.

Any question please