Frameshift mutation worksheet (continued) CTCTTCACTAATTCGGGCGGATTTCCCGAAAAAAA GAGAAGUGAUUAAGCCCGCCUAAAGGGCUUUUUUU GLU LYS 5' DNA 3' RNA protein 3' RNA protein 3' RNA protein 3' RNA protein 3' RNA protein

**not sure if you needed the second picture** Please complete number one. Explain how to figure it out. Thank you so much!

Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG

Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T …  What’s the mRNA sequence? (Circle the change)  What will be the amino acid sequence?  Will there likely be effects? What type of mutation is this? ________________________________

9

15

RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…

Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)

Question Completion Status: Use the codon chart below to help answer the questions: Codons Found in Messenger RNA Second Base U C G Phe Ser Тyr Тyr Stop Cys Cys U Phe Ser Leu Ser Leu Ser Stop Trp Arg. U Arg Arg Arg Leu Pro His Leu C Leu Pro His Pro Gln Leu Pro Gln lle Thr Asn Ser U A lle Thr Asn Ser lle Thr Lys Arg Arg Met Thr Lys Asp Asp Val Ala - Gly Gly Gly Gly Val Ala Val Ala Glu Val Ala Glu A. Transcribe the DNA sequence TACTAAACACCGATT into mRNA (do not include any spaces in your answer): B. Where in a Eukaryotic cell does the process in part A take place? C. Translate the mRNA sequence from above into the amino acid sequence (in your answer, use the 3 letter abbreviations from the table above, and separate each amino acid with a space): D. If a molecule of DNA contains 22% thymine, what percentage of cytosine would it have? Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All An First Base DCAGD CAGUCAGUCAG Third Base

Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________  Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________