Explain the role of carnitine in the energy supply of the myocardium
Q: What is the dissociation equilibrium constant of a protein if the concentration of free ligand is…
A: Consider the following reaction: P + L ⇌k2k1 PL where P is the protein, L is the ligand and k1 and…
Q: The key regulatory enzymes in glycolysis are: A) hexokinase, phosphofructokinase, and pyruvate…
A: In the anaerobic process of glycolysis, one glucose molecule is transformed into two pyruvate…
Q: Q2. Circle true or false for each stat ni bavlovni smyno sto siqmsxs n6 zi sbimsoqu 1) T F Oxygen…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: Ammonia enters the urea cycle as: OA) aspartate. OB) glutamate. OC) carbamoyl phosphate. D) NH4*.
A: The urea cycle is the main metabolic pathway involved in the removal of nitrogenous waste that is…
Q: he human body requires various nutrients which are essential for health and can be obtained from a…
A: Proteins are comprised of amino acids polymer linked by peptide/amide bonds. Fats are insoluble…
Q: iccharide. A チ OH CH₂OH 3 OH 3 с loftes to right alpha-glucosidic Bond. B 6 CH₂OH H OH 2 OH H CH₂OH…
A: Carbohydrates can be classified into monosaccharides ,oligosaccharides and polysaccharides.…
Q: Please type out answer and need 200 word or more response Propose a reason for why so many of the…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: 1 Draw the following polypeptide: Met- Tyr-Val-Ser-Asn 2A Draw the hydrolysis of a dipeptide…
A: A peptide is a chain of amino acids, in which the amino acids are joined together through peptide…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: *One possible hereditary metabolic defect is the inability to synthesize the enzyme glycogen…
A: Hereditary metabolic defects are those diseases in which a non-functional gene variant whose…
Q: Task #3: Design primers 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61…
A: A primer is a short single-stranded nucleotide chain used for the initiation of DNA synthesis. In…
Q: )picture1: what bond is this between cytosine and ribose? 2)picture2 : what bond is that bewteen…
A: Nucleotides are compounds made up of a nitrogen base, a sugar and a phosphate. The base can be…
Q: Circle the functional groups on the R-group of the AMINO ACIDS below that are capable of forming…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: What are the buffering ranges for this titration curve? Please tell the ranges and indicate on the…
A: Titration is a lab procedure that is used for determining the amount of acid in a solution. Sodium…
Q: The carbon-carbon bond distance for single-bonded carbons, such as those in a saturated fatty acyl…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Sugar Molisch's Solution Test Glucose Sucrose Lactose Hydrolysis: Samples Sucrose hydrolysate Starch…
A: Glucose , sucrose, lactose, starch all are carbohydrates. Glucose is the simplest carbohydrate of…
Q: Metabolic enzymes are often found in large multi-enzyme complexes. What are the benefits of this…
A: Enzymes are biological catalysts that catalyse biochemical reactions. Substrates bind to the free…
Q: Explain the rationale of dissolution of drugs according to pH? What is the pH of gastric fluid? What…
A: Dissolution of drugs is the process by which drugs dissolve in a liquid medium (generally the…
Q: lon X has an equilibrium potential of Ex = -50 mV. At the resting membrane potential (-70mV), which…
A: Ions can move either way across a membrane but the direction of movement depends on membrane…
Q: Question 13 1 The binding of seven molecules of ATP at the apical domain of the GroES causes the…
A: Since you have asked multiple questions, we will solve the first question (Question No. 13) for you.…
Q: What is the effect on the biosynthetic pathways if the oxidative branch of a person’s pentose…
A: The pentose phosphate pathway (PPP) is an alternate pathway to metabolize Glucose 6-phosphate…
Q: In humans, apolipoprotein B48 is found on: A) Chylomicrons. OB) HDL. OC) IDL.
A: The apolipoprotein is a protein component of plasma lipoprotein that is capable of binding and…
Q: a) Draw the 5’-monophosphate-2’-deoxyguanosine nucleotide covalently bonded with neighboring DNA…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: 1. 2. NaBr 3. H₂O₂ 4. Al₂(MoO4)3 5. AgNO3 Fe₂(SO4)3
A: In one molecule of a compound how many numbers of atoms of each element are present is…
Q: Which of the conditions would result in the greatest amount of transcription of the lac operon? I.…
A: Gene expression essentially involves the production of the polypeptide chain that a certain gene has…
Q: ✓ Part B What further experiment should be carried out in order to determine the primary structure…
A: Introduction Protein is the most abundant macromolecule in our body. Amino acids are the building…
Q: TRUE OR FALSE 1. The H chain contains one variable and one constant domain. 2. The processes that…
A: Immunoglobulins are the Y shaped complex molecules that are proteins in nature.they can be referred…
Q: give an example of how signal transduction plays a role in disease
A: Introduction: Our human body undergoes various processes to coordinate individual cells to support…
Q: Many metabolites are transported either actively or passively across mitochondrial outer and inner…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: Control of transcription in prokaryotes does not involve enhancers silencers Histone coding O…
A: Enhancers and silencers are DNA sequence acting as regulatory elements which acts as "turn on" or…
Q: compare that hypothetical mechanism to the classical presentation described in our textbook. What…
A: ETC is an arrangement of protein complexes and some non-protein components in an increasing redox…
Q: What type of rotational (cyclic) symmetry is apparent in the structure? O Six-fold. O Seven-fold. O…
A: SARS COV-2 belongs to the coronavirus family. It has many proteins that form the complete structure,…
Q: State the function and desired products of the hexose monophosphate shunt pathway.
A: Cells metabolize glucose molecules through the glycolytic pathway to release the energy required for…
Q: Which of the following mutations is most likely to cause a loss of protein function? O a. Silent…
A: As per the central dogma of biology, the genetic information stored in the DNA is copied onto an…
Q: B. Given that five molecules of glucose in eukaryotes underwent full oxidation and entered ETC, how…
A: ATP is the energy currency of the cell also known as 'molecular unit of currency', where it breaks…
Q: Which of the following has the lowest probability of cardiac event-free survival? high CRP and…
A: Introduction LDL (low-density lipoprotein) is also known as bad cholesterol. It can cause blockage…
Q: what is main difference for B-DNA,A-DNA and Z-DNA
A: The two fundamental types of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: what is the classification and biosynthetic pathway for the following: geoghin HO OH
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Question 15 The GroES subunit has 14 identical 549-residue subunits arranged in two stacked rings…
A: GroEL-ES is a molecular chaperone complex that assist in the folding of cellular proteins. The…
Q: Glyoxylate cycle allows the conversion of __ to __ in __ A. Glucose ;lipids ;plants B. Lipids;…
A: The primary source of energy for living cells is carbohydrates. The key molecule in the metabolism…
Q: Question 22 Which is not a structural motif for DNA binding? αβα motif Zn Finger leucine zipper…
A: Proteins are true polymers, which are composed of amino acid units. Proteins have four levels of…
Q: Determine how many molecules of ATP are produced from the ß-oxidation of myristic acid. molecules of…
A: Fatty acids metabolism involves β-oxidation which happens in the mitochondrial matrix. In…
Q: Which of the following polypeptides CANNOT be phosphorylated? a. O b. -LIYLIA- -ASILD-
A: The proteins are constituted of twenty naturally occurring amino acids that are linked together via…
Q: Consider a defect in MIG12 that prevents the binding of this protein to acetyl-CoA carboxylase. How…
A: Introduction: Acetyl carboxylase is a multifunctional enzyme that contains three functional domains…
Q: The following are effects. role of glycosylation, EXCEPT molecular recognition in immunologic…
A: Since you have posted multiple questions we will answer the first question for you. Please repost…
Q: Identify the steps in the glycolytic and citric acid cycle pathways where ATP, GTP, NADH, and FADH2…
A: Introduction Citric acid cycle is also known as tricarboxylic acid (TCA) cycle. It is an important…
Q: TRUE OR FALSE 1. Carboxybiotin is covalently linked to an enzyme via E- amino group of a lysine…
A: An enzyme is a substance that acts as a catalyst in the living systems. It increases the rate of…
Q: Consider the equilibrium of arginine below: NH₂ NH₂ H₂N: 0 NH OH H₂NE pKa-2.17 NH3 NH H₂N: pKa 9.04…
A: The proteins are constituted of 20 naturally occurring amino acids. The net charge on an amino acid…
Q: 3 4 Ag₂O NH₂OH, H₂O KMnO H₂O*
A: 3. This is an example of Tollens's reaction. Where Ag2O and NH4OH reacts to form ammonical silver…
Q: This assay is the most common method of detection in enzyme assays: A. рН B. spectrophotometric…
A: Enzymes are the biological catalysts that can convert substrate molecules to products. Enzyme assays…
Explain the role of carnitine in the energy supply of the myocardium
Step by step
Solved in 2 steps
- Explain how the connective tissues of the myocardium are similar to the tendinous origins and insertions of skeletal muscles.Identify and describe the structure shown in the figure below. What role does this structure contribute to the functional myocardium? Identify the structure shownDefine myocardium
- Explain why part of the myocardium is nonfunctionalfollowing myocardial infarction.(vii) What is creatine phosphokinase (CPK) and why are elevated CPK levels in the blood suggestive of a myocardial infarction? (viii) What is cor pulmonale? (ix) Describe the main clinical findings (with cor pulmonale) on examination. Explain your answer.Describe the pacemaker potential and the myocardial action potential, and explain how the latter correlates with myocardial contraction and relaxation.