please help with graph questions thanks you! Consider this action potential drawn below.23. What causes the depolarization of the membrane at A?24. What causes the repolarization of the membrane at B?25. Why does the membrane hyperpolarize at C?26. What triggers gating of delayed K rectifying channels?27. Explain what inactivation of the Na channel is and why it is important to A?28. Explain how an action potential is propagated along an axon?29. What prevents an action potential from reversing direction along an axon?30. Explain how excitatory neurotransmitters generated an action potential31. Explain how an inhibitory neurotransmitter can prevent the generation of an action potential.32. Outline how an action potential in a nerve cell results in muscle contraction.Membranepotential+40mVA-70mVCTimeB.

Answer 23-Depolarization of the membrane at A is due to the opening of the Voltage-gated Na channel.…

Answered: e help with graph questions thanks…

Science

Biology

e help with graph questions thanks you!

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter39: Information Flow And The Neuron

Section: Chapter Questions

Problem 5TYK: The major role of the Na+/K+ pump is to: a. cause a rapid firing of the action potential so the...

See similar textbooks

Related questions

Q: What is this molecule? (Looks scary but look how it has those tails [Select] Which are highly polar?…

A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: ▾ Part A Penetrance specifically refers to the expression of lethal genes in heterozygotes. O True O…

A: Gene expression is a central process in biology that controls the development and functioning of…

Q: Find the pH of the equivalence points when 28.9 mL of 0.0850 M H₂SO3 is titrated with 0.0752 M NaOH.…

A: At the first equivalence point, all the H2SO3 is converted into its conjugate base, HSO3-. To…

Q: #5: What factors contribute to Uranus experiencing "the most extreme seasons in the Solar System"?…

A: The seventh planet from the Sun with the third biggest width in our planetary group, Uranus is…

Q: Select all that apply about 02 and CO2. O Both are nonpolar molecules. Both can diffuse passively…

A: The gases oxygen and carbon dioxide are critical components of the earth's atmosphere. This is…

Q: All of the following are epigenetic mechanisms that can influence a gene's function EXCEPT? O…

A: The epigenetic control of DNA occurs when the changes in the phenotype occur without a change in the…

Q: AKS 5c1: Use the model below to answer the question that follows. Which interpretation of this model…

A: Cell is a structural and functional unit of living organisms. Several cells joined together to form…

Q: AKS 5b: Use the models beklow to answer the question that follows. Whic model and explanation best…

A: Conservative replication leaves the two original template DNA strands together in a double helix and…

Q: Cheatgrass is an annual grass plant native to Eurasia that was unintentionally introduced into the…

A: Introduction: A population is all the organisms of the same group or species, which live in a…

Q: nple of a gain-of-function experiment? pholinos to test the function of MyoD e-targeting to test the…

A: Gain of function means when the foreign DNA is inserted in anyone of the concerned cells, the gene…

Q: 50 microliters of your original sample to the Bradford reagent. What is the concentration of your…

A: Proteins are made up of amino acids that have been polymerized. As a result, amino acids are…

Q: Please help! Thanks in advance

A: Hi there! We do not cater opinion based question. Since question 1 is an opinion based question, we…

Q: Anabolic pathway A. Energy required to make a chemical reaction proceed forward Exergonic B. Second…

A: Reactions refer to the chemical process involving the reactants to form different substances called…

Q: Which of the following is not a type of RNA? mRNA pRNA tRNA rRNA

A: The term "RNA" stands for ribonucleic acid, which is a complex substance with a high molecular…

Q: Descriptive terms used to describe colony morphology: C Colony #: form:…

A: Bacteria grows on solid media in the form of colonies. *A colony is the visible mass of…

Q: Select the correct order of the building blocks to create a protein. RNA-DNA-amino acids-protein…

A: Introduction : Proteins are large molecules made up of the building blocks known as amino acids.…

Q: light 6CO2 +12H20 -> C&H12O6 +6 H20+602 chlorophyll 7. The name of this chemical equation is a)…

A: Metabolism refers to all the chemical reactions occurring in the body that are involved in…

Q: AKS 5c1: The model below shows the process of protein synthesis. What is the best explanation for…

A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms,…

Q: D. Hardwood forest stage C. Pine forest stage A. Grass stage B. Shrub stage Bare field 1. What…

A: 1. In the diagram, succession concept is illustrated as initially it is the bare field and then…

Q: Use the information in the figure, below. Include units in your answer. Round numbers to 3 decimal…

A: BSA standard curve: Bovine Serum Albumin(BSA) is a Globular protein that is being used as a standard…

Q: Interpretation: $in Tachyrardie ACLS Algorithm AYA ACLS "TAchycardin A! gorithim PR:1se ORS: A06…

A: ECG (electrocardiogram) is the graph generated by sensing the electrical impulses of the heart.…

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…

Q: 5. Antlions can experience competition

A: A tight ecological link between members of two (or more) distinct species is known as symbiosis.…

Q: Refer to the figure showing a pair of homologous chromosomes. What process is demonstrated in this…

A: Introduction Meiosis is a type of cell division that occurs in sexually reproducing organisms' germ…

Q: I. MULTIPLE CHOICE DIRECTIONS: Encircle the letter that corresponds to the correct answer. Avoid…

A: We are allowed to do upto 3 MCQs. Please repost the undone question again. Thank you for choosing…

Q: 1. Homologous chromosomes line up at the equator (or the middle) of the cell. Metaphase I 2. Spindle…

A: Cell division is an important process that helps to keep the cells growing in number. This enables…

Q: AKS 5c1: A section of a nucleic acid is shown in the model below. The process represented in the…

A: Nucleic acids are one of the most important biomolecules of living system. There are two types of…

Q: Which classification(s) is(are) applicable to maltose? CH,OH CH,OH H H H. OH OH H OH H H HO H…

A: Disaccharides are composed of two monosaccharides attached together via glycosidic linkages. The…

Q: Marlene Zuk and her colleagues' work on the field cricket T. oceanicus provided insights into how…

A: Natural selection drives the process of evolution.

Q: 13. Identify the numbered processes (1, 4, and 6) and structures (2, 3, and 5). · 1 6 (diploid) 2n 2…

A: The organism that reproduce by sexual reproduction will produce gametes by the male and female…

Q: The following is a map of four genes on a chromosome: A and E A A and G OW and E A and W 5 E and G W…

A: Recombination frequency: During the process of meiosis the frequency at which two genes occurring…

Q: You are trying to annotate a new phage genome; which program or programs should you use to determine…

A: Phamerator is computational tool that is designed to sort out phage genes into phage families of…

Q: 7. In 2010, a boating company in Fiji began taking tourists onto the ocean to view bull sharks. They…

A: Introduction A population is a group of individuals of the same species that live and interact…

Q: Analyzing the Elements of a Scientific Method Read the following story and then answer the…

A: Scientific research is an process for seeking knowledge to test the hypothesis by various…

Q: Identify the components of skin in the accompanying diagram. а. Hair b. Sebaceous glands С. d. Sweat…

A: Skin is a layer of usually soft, flexible exterior tissue that covers a vertebrate animal's body and…

Q: Which of the following statements about learning is false? Natural selection can operate on the…

A: Introduction: The theory of natural selection was given by Sir Charles Darwin in the year 1859.

Q: 1.Fill out the table below with the test results (Please use the ABO blood typing guide to verify…

A: ABO blood grouping was discovered by Karl Landsteiner in 1900. He gave the blood groups A, B, O, and…

Q: AKS 5c1: A researcher is examining the DNA sequences of a group of mice. He notices that in one of…

A: Silent mutation It is the change in the sequence of the nucleootide bases of the DNA. This change…

Concept explainers

Intelligence

Intelligence refers to the intellectual functioning that compares a person's intelligence quotient (IQ) with other people of the same age. In other words, it is the ability to understand circumstances or situations and arrive at appropriate solutions. Both animals and plants exhibit intelligence.

Question

please help with graph questions
thanks you!

Consider this action potential drawn below.
23. What causes the depolarization of the membrane at A?
24. What causes the repolarization of the membrane at B?
25. Why does the membrane hyperpolarize at C?
26. What triggers gating of delayed K rectifying channels?
27. Explain what inactivation of the Na channel is and why it is important to A?
28. Explain how an action potential is propagated along an axon?
29. What prevents an action potential from reversing direction along an axon?
30. Explain how excitatory neurotransmitters generated an action potential
31. Explain how an inhibitory neurotransmitter can prevent the generation of an action potential.
32. Outline how an action potential in a nerve cell results in muscle contraction.
Membrane
potential
+40mV
A
-70mV
C
Time
B.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The major role of the Na+/K+ pump is to: a. cause a rapid firing of the action potential so the inside of themembrane becomes momentarily positive. b. decrease the resting membrane potential to zero. c. hyperpolarize the membrane above resting value. d. cause an action potential to enter a refractory period. e. maintain the resting membrane potential at a constantnegative value.
Use this illustration to place these events in the order they occur during synaptic communication: Column A Column B a. Voltage gated sodium channels carry the action potential to the synapse by allowing the influx of sodium ions. 1. 1 2 b. An increase in calcium levels triggers vesicle release. 3. 3 c. Sodium enters the post-synaptic cell, causing it to depolarize. 4. 4 d. Sodium influx at the synapse activates voltage gated 5. calcium channels which allow calcium ions to enter the presynaptic neuron. 6. 6. e. Neurotransmitters are released into the synaptic cleft. f. Ligand-gated ion channels are opened by the neurotransmitters. 2.
Neurotransmitters: a. Can only inhibit the postsynaptic cell b. Can be part of a process that regulates transcription and translation in the postsynaptic cell с. Are bound to their receptors forever, until the receptor is degraded and recycled. d. Can exit the presynaptic cell without assistance. e. Can only excite the postsynaptic cell Clathrin: Is embedded in the cell membrane of the synaptic terminal. a. b. Degrades vesicles for recycling and return to the axon hillock с. Mediates ALL endocytosis in the body, including the formation of vesicles in the synapse. d. Forms a coat of octagonal proteins. e. Helps the vesicle leave the pre-synaptic cell, and fuse to the membrane of the post-synaptic cell
What membrane protein of the neuron is responsible for briefly increasing the Na+ permeability of the membrane during the rising phase of the nerve impulse? a. the sodium-potassium pump b. the voltage gated potassium channel c. the voltage gated sodium channel d. the stimulus gated sodium channel e. the ligand gated ion channel
What does a ligand-gated channel require in order to open?a. increase in concentration of Na+ ionsb. binding of a neurotransmitterc. increase in concentration of K+ ionsd. depolarization of the membrane
Which channel is activated by hot temperature? A. AMPA receptors B. voltage-gated K channels O C. voltage-gated Nat channls D.voltage-gated Ca2" channels E. TRP channels
The figure below may help in answering some of the questions. 1. What ions are flowing (and in which direction) both during the rising phase and the falling phase of the action potential? 2. What are the values of both the 'y' (vertical) axis and the 'x' (horizontal) axis. 3. If extracellular levels of K+ rose (a condition called hyperkalemia), how would that affect the resting membrane potential? 3
What's the consequence of glutamate release when the postsynaptic membrane expresses NMDA but not AMPA receptors? a. NMDA receptors conduct sodium in the absence of a membrane depolarization b. NMDA receptors couple to G-proteins; activation opens up downstream sodium channels c. Calcium passively diffuses into the neuron triggering neurotransmitter release d. Magnesium blocks the pore of the NMDA channel prohibiting sodium influx
On the graph above, when do the sodium ion channels close? Select one: a. between 0.2 ms and 0.5 ms, which is when depolarization occurs b. at 0.2 ms, which is when depolarization occurs c. at 0.5 ms, which is when repolarization begins d. between 0.5 ms and 0.8 ms, which is when repolarization occurs
Using cable theory to describe axon conduction would tell us a. the larger the diameter of the axon the faster the propagation of the action potential b. the larger the diameter of the axon the slower the propagation of the action potential c. the smaller the diameter of the axon the faster the propagation of the action potential d. that having big axons is of no benefit and only takes up a lot of space e. the nervous system mainly has small axons because they are much faster than large ones
The nerve impulses always travel in one direction from dendrites to axon terminals. What prevents an action potential from travelling backward? a. Hyperpolarization of the neuron makes the membrane more positive and prevents another action potential. b. After repolarization, the refractory period occurs, where the sodium ions are found outside the cell. c. After repolarization, the reversal of ions prevents another action potential as there would not be enough sodium ions outside the cell to rush in. d. The refractory period prevents another action potential by lowering the threshold potential.
Voltage-gated Na+ channels open upon reaching what state? a. resting potential b. threshold c. repolarization d. overshoot