DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & III

Q: Considering the structure of DNA, what kind of bonds hold one nucleotide to another within one side…

A: We know that DNA is the molecule which store the biological information . It is a complex molecule…

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…

A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…

Q: What is the polypeptide that will be formed from the following DNA sequence?  Template DNA…

A: In molecular biology complementary base pairing or complementarity is a reletion between the two…

Q: Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna…

A: In molecular biology, the process of protein synthesis involves the conversion of genetic…

Q: Molnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA…

A: Mutations are sudden changes in the genetic material which can be either DNA or RNA.Molnupiravir is…

Q: functions. The structure that provides high processivity (processivity factor) is represented by the…

A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…

Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…

A: Central dogma is the process where in the information stored in nucleic acids is transferred to…

Q: The coding strand has the following sequence. Please answer the questions below with regard to this…

A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…

Q: Statement Replication Transcription The new strand is made 5' to 3'. The new strand is made 3' to…

A:

Q: The purpose of DNA gyrase in replication is: to relieve positive supercoiling induced by unwinding…

A: Introduction: The process of DNA replication involves the production of an exact copy of genetic…

Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The following strand of DNA is transcribed: 5'-GACCTCCGAATGC-3' Write the sequence of the…

A: Transcription:  It is the process of synthesis of mRNA from double-stranded DNA by the enzyme RNA…

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: Label the 5'  and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription.  In this process a molecule of mRNA is synthesized…

Q: Acyclovir can be used to treat severe cases of Epstein-Barr viral (EBV) infection, but has little to…

A: Introduction:Acyclovir is an antiviral drug commonly used to treat infections caused by…

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…

A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…

Q: For the template DNA below, which includes one labeled end of the template DNA, clearly label the…

A: DNA replication is a fundamental process in which a cell's genetic material is duplicated, ensuring…

Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: DNA polymerase III (the main polymerase) Helicase DNA ligase Single-stranded binding proteins DNA…

A: DNA replication is the process by which new DNA strands are produced from the old DNA strands by the…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CACGGGG-3'

A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…

Q: Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this…

A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: copy of a molecule of DNA. In this process, the joining of nucleotides to extend a new strand of DNA…

A: DNA replication is a process in which DNA makes its daughter stand by making a copy of the original…

Q: Using the straight-chain sugar convention where the vertical lines represent sugars and the…

A: DNA is the genetic material in all living organisms and it is made up of thymine, adenine, guanine,…

Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…

A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…

Q: Describe the d=features of the following DNA-binding domains and how they interact with DNA.…

A: DNA-binding domain abbreviated as DBD is a protein domain that is folded independently and contains…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: What is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the…

A: All living organisms are made up of cells, which are the most basic unit of life. They are…

Q: 5 to 3 direction, the DNA template strand should be  5'TTT-GGG-AAA-3'

A: mRNA and DNA are two types of nucleic acids that play crucial roles in gene expression and protein…

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.