Determine whether each of these events of eukaryotic DNA replication is associated with leading strand synthesis or lagging strand synthesis or both. Primase begins RNA polymerization de [ Choose ] novo. DNA polymerase synthesizes DNA 5' to 3' [ Choose ] Ligase joins Okazaki fragments together. [ Choose ] DNA polymerase replaces RNA primers [ Choose ] with DNA. > > > >

Determine whether each of these events of eukaryotic DNA replication is associated with leading strand synthesis or lagging strand synthesis or both. Primase begins RNA polymerization de [ Choose ] novo. DNA polymerase synthesizes DNA 5' to 3' [ Choose ] Ligase joins Okazaki fragments together. [ Choose ] DNA polymerase replaces RNA primers [ Choose ] with DNA. > > > >

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

Match the enzymes involved in DNA replication with their function. Primase [ Choose ] [ Choose] Synthesizes short RNA segment to initiate new DNA strand Helicase Main enzyme that extends RNA primer by adding DNA nucleotides to it Stabilizes single-stranded DNA Relieves over-winding of DNA ahead of the replication fork Removes RNA primers preceding Okazaki fragment and replaces RNA nucleotides with DNA nucleotides Single-stranded binding proteins Unwinds DNA helix Synthesizes the ends of the linear chromosome Seals nicks between adjacent DNA segments DNA polymerase III [ Choose ] DNA polymerasel [ Choose ] DNA Ligase [ Choose ] Topoisomerase [ Choose ]
All known DNA polymerases catalyze synthesis only in the 5' → 3' direction. Nevertheless, during semiconservative DNA replication in the cell, they are able to catalyze the synthesis of both daughter chains, which would appear to require synthesis in the 3' → 5' direction on one strand. Explain the process that occurs in the cell that allows for synthesis of both daughter chains by DNA polymerase
Deoxyribonucleoside triphosphates are the necessary and fundamental monomers for polymerization of DNA. However, DNA replication also requires ribonucleoside triphosphates. Why? More than one answer is correct. Question 8 options: new DNA chains are initiated on an RNA primer synthesized from ribonucleoside triphosphates by primase. DNA helicase uses the energy of ATP (a ribonucleoside triphosphate) to unwind the DNA double helix before DNA synthesis can occur. unlike DNA polymerase epsilon, DNA polymerase delta incorporates ribonucleotides into the growing polymer to synthesize the lagging strand ribonucleoside triphosphates are converted into deoxyribonucleoside triphosphates by DNA polymerase immediately before incorporation. DNA is first synthesized as RNA which is converted to DNA by removal of the 2'-OH (2' hydroxyl) from the pentose sugars in the backbone by DNA polymerase.
Which of the following statement(s) is/are false/incorrect? You may select multiple options, if necessary. ☐ Experiments support bidirectional movement of multiple replication forks at eukaryotic chromosomes. O Mg++ ions play important roles during DNA synthesis Synthesis of DNA is semi-conservative ✔ Beta clamp reduces DNA polymerase processivity ✔ DNA polymerase III uses ATP as a source of energy to drive the polymerization reaction forward O Tautomers enhance chances of correct nucleotide incorporation during DNA synthesis
Adenylate cydase, which synthesizes cyclic AMP from ATP, requires two metal ions, and the enzyme has the same constellation of amino acid residues in the active site as does DNA polymerase I. In what sense is the adenylate cyclase reaction similar to that of DNA polymerase, and in what sense is it different?
Match the enzyme on the left with its role in DNA replication DNA polymerase I helicase DNA ligase DNA polymerase III topoisomerase primase 72 W w# 3 E $ 4 R % 5 T A 6 MacBook Pro Y & 7 U * 8 replaces primers with DNA connects Okazaki fragments to form a continuous strand of DNA synthesizes short RNA fragments used to initiate DNA synthesis Uses the 3'OH of an RNA primer to synthesize the leading strand and Okazaki fragments keeps DNA from getting tangled up ahead of the replication fork "unwinds" the DNA double helix at the origin and replication forks 1 ( 9 X 0 0 P + 11 Next
During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked by DNA ligase. This is because O replication starts at many points on the chromosome RNA primers only anneal to one of the parental strands of DNA one of the parental strands is unwound slower than the other by helicase DNA polymerase III only synthesizes DNA in the 5' - 3' direction
Replication in eukaryotes begins at the OriC sequence. This particular sequence is characterized by (select the correct statements): A-T rich and therefore energetically more favourable to localy unwind DNA. Contains the DnaA boxes. Recruits histone acetyltransferases. Is locally unwound by DnaA, HU and IHF proteins. QUESTION 16 The Single Strand-binding proteins (SSBS) in prokaryotes and the Replication Protein A (RPA) in eukaryotes are functionally equivalent. Their role in the DNA replication process is to (select the correct statement): Stabilize the single stranded DNA structure after unwinding by the DNA helicase. Recruit the general transcription factors to the promoter. Relieve the torsional stress ahead of the replication fork. Induce double strand breaks. O O O O O O O
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
Which of the following is/are true regarding the enzyme primase? a: primase functions during cellular DNA replication. b: without primase activity, DNA polymerase in our cell can NOT begin synthesizing new nucleotide chains. c: primase uses dNTP building blocks d: primase is a polymerase enzyme e: primase functions AFTER DNA helicase activity. Ps: This has multiple answers. thank you.
(d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I II
Adenylate cyclase, which synthesizes cyclic AMP from ATP, requires two metal ions, and the enzyme has the same constellation of amino acid residues in the active site as does DNA polymerase I. In what sense is the adenylate cyclase reaction similar to that of DNA polymerase, and in what sense is it different?