Determine whether each of the examples or phrases describes an essential amino acid, a nonessential amino acid, or both essential and nonessential amino acids. A table of amino acids. Essential amino acids threonine leucine obtained from food only Nonessential amino acids synthesized by humans an amino acid synthesized from pyruvate in humans Both derived from 3-phosphoglycerate, a glycolytic intermediate the amino acid that is a thioether branched-chain amino acids

Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…

A:

Q: A few proteins are naturally fluorescent, what physical and chemical factors of the proteins allow…

A: Fluorescent proteins have been appreciated in the field of biology because of their contribution in…

Q: CHOICE MAKING

A: Choice making is a fundamental aspect of person-centered planning, which aims to empower individuals…

Q: muscular dystrophy: this genetic disease continue to affect many americans and we are not closer to…

A: Muscular dystrophy is caused by a group of disorders that involve a progressive loss of muscle mass…

Q: Write about typeB, typeA and typeZ DNA.

A: DNA is deoxyribonucleotide and is made up of nitrogenous base, sugar and phosphate.

Q: Recognize the following types of biomolecules when given images such as the ones below and on the…

A: Biomolecules are carbon-containing organic molecules present inside or synthesized within living…

Q: please choose statements/concepts that relate to SCIENCE that begins with letter X X letter should…

A: As we know that science is the study of knowledge , technologies based on experiments. There are…

Q: Pick 10-15 words from the attached picture and make a concept map. Use words from different units,…

A: Eukaryotes and Prokaryotes are two categories into which all living things can be subdivided based…

Q: As you watch the video, answer the questions. The questions are in sequential order. 1) True or…

A: We are not supposed to use external links so answer are based in general point of view. Also in case…

Q: According to the video, explain one of the following results that happened after a population went…

A: The objective of the question is to understand the impact of traumatic events, specifically famines…

Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…

A: Unlike bacterial RNA polymerase, the eukaryotic RNA polymerase cannot initiate transcription in…

Q: Your fingerprints are different from the person sitting next to you. What is responsible for this?

A: Fingerprints are unique for every individual. There are no evidences found where two individuals are…

Q: True/False Question (suggested time - up to 1 minute): The amino acid sequence of a given protein…

A: Mutation is the sudden inheritable change in the genotype. The process by which the mutation is…

Q: Mandela Day

A: Nelson Mandela International Day was launched in recognition of Nelson Mandela's birthday on 18 July…

Q: Please identify the name of human chronic disease in the below figure and what are the dietary cause…

A: Answer:  CHRONIC DISEASES : It is the condition in the human body in which a disease can persist for…

Q: Subparts #10-13 needed please.

A: Phase III clinical trials is used to determine the long-term effects of a drug.

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: DefubeAIDS is termed a syndrome more than a disease.

A: Acquired immune deficiency syndrome (AIDS) can be acquired in a variety of ways, including immune…

Q: 5'--AUG UCG UAC ACU GCG --3' Make a change in this sequence. Write a different version of this…

A: Given  mRNA sequence  5' AUG UCG UAC ACU GCG 3'   Mutation  The sequencial change in the nucleotide…

Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Songbirds sing using a type of muscle fiber called super fast-twitch muscles. These super…

A: Muscle contraction and relaxation are regulated by the levels of calcium ions in the sarcoplasm…

Q: 5. What is Bacteriophage typing?

A: Bacteriophages are viruses that target and destroy bacteria. Viruses can be broadly divided into two…

Q: Healthy life excricising healthy body

A: The human body is a well built machine in which all the organs coordinate together to make it work.…

Q: Briefly explain how enzymes speed up a chemical reaction.

A:

Q: Below is a picture of the base of a hair. The section that is referred to as the matrix is shown in…

A: Skin is the largest organ of the integumentary system that covers the body and provides three main…

Q: 1) Genetically Modified Organisms (GMOS) What are GMOS? Describe fully Identify a plant that has…

A: Step 1 Hello. Since you have posted a question with multiple sub-parts, we will solve the first…

Q: To make a banana split you have a banana into two long,thin,right and left sides along the

A: Let us draw a human face and human organs like 2 eyes, a nose, mouth, 2 ears, 2 arms, 2 legs on a…

Q: Create the complementary DNA strand: GCG-CAT-TAC-ATG Your answer

A: Complementary DNA It is DNA synthesized from a single stranded RNA template in a reaction catalyzed…

Q: Beta glucan is a form of soluble fiber that can reduce blood cholesterol. is a protein that contains…

A: Beta glucan is a type of soluble fiber that is found in various sources such as oats, barley,…

Q: what animals these furs belong to, from the top, middle, and bottom

A: Animal pelts Animal pelts are typical of the external skin of animals(wool) which keeps the animal…

Q: Match each statement with column B(can only be used once). Thank you.  Subparts #14-25 needed…

A: TNM is tumour staging: T- Tumour N-Lymph node involvement M- Metastasis Taxol is an anticancer drug…

Q: Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding…

A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Q: Write a brief paragraph about what a scientist could do with DNA. Could you please help me with…

A: DNA is the genetic material in most of the organisms including hunan. It is a nucleic acid that…

Q: 3 1. -4 5 2-

A: Arteries and veins (commonly known as blood vessels) are muscular tubes through which blood flows.…

Q: I want information about pectin , structure of pectin and source of it ?

A: Pectin is a heteropolysaccharide with a complex structure that constituents one of the main…

Q: I need help with the following questions and there are multiple parts and I dont understand!…

A: Gene therapy is a process that involves the transfer of genetic material (a gene) into the cell of a…

Q: For some people, an insect sting can cause a(n)

A: In some people, insect sting can cause an allergic reaction.

Q: Occluding junction is serves as a channels for communication between adjacent cells. O False O True

A: Cell junctions are structures created by a few different transmembrane proteins, whose principal…

Q: Luis is 85 years old. The following things could happen to Luis. Put the items in the most likly…

A: Nursing counselling and advise involves certain intervention which helps process focusing on the…

Q: Question 4 Smooth muscle multiple nuclei True False

A: The muscles which are non-striated, involuntary in nature and found in the visceral organs are known…

Q: Dought a used car, It is old and has a bit of rust on it, but he is proud to have saved his money up…

A: The looking glass self orientation, as the name suggests, depicts how a person views his self worth…

Q: list difference between DNA and RNA.

A: DNA and RNA are the two types of nucleic acids known as deoxy ribonucleic acid and ribonucleic acid…