Describe what happens to the DNA when the helicase unwinds the double helix. What can Topoisomerases do to alleviate it? What can happen when it doesn’t?

Q: what are some examples where DNA polymerase is not functional and translesion DNA synthesis has to…

A: Dna polymerase are the enzyme that helps in DNA synthesis. It has the ability to synthesize the DNA…

Q: A DNA strand has the following sequence:      5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: ents the biochemical reaction that occurs durin

A: Introduction:-  DNA synthesis is the biological process by which a deoxyribonucleic acid(DNA)…

Q: The enzymatic activity of the DNase I variants was tested using a DNA hyperchromicity assay. The…

A: Enzymes are proteinaceous entities responsible for carrying out as well as boosting the overall rate…

Q: A DNA strand has the following sequence:   5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’   In which…

A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…

Q: What do the enzymes topoisomerase I and topoisomerase II have in common? a) They both have nuclease…

A: DNA can be super coiled during the replication and transcription process. Topoisomerase is an enzyme…

Q: Each peak in a chromatogram corresponds to: A fluorescent ddNTP which has been released from the…

A: Ans-.  A fluorescent ddNTP which has been incorporated into the DNA fragment resulting in the…

Q: A mutation occurs that changes a codon from UCC to UCA. It turns out that this codon is for an amino…

A: Based on the nature of change that occurs in a codon due to a point mutation (mutation at a single…

Q: the replication fork is getting stuck. Upon further investigation, you discover that the DNA is…

A: DNA supercoiling is a higher-order of DNA structure that can confer special structural and energetic…

Q: explain the laws of DNA polymerase? Why are they important and are all the laws required for DNA…

A: DNA polymerase is the enzyme that is helpful in catalysing the DNA molecules synthesis. There are…

Q: DNA polymerase contains an arginine residue that is important for binding to DNA. Mutations were…

A: DNA polymerase contains an arginine residue that is important for binding to DNA. Mutations were…

Q: the human immunodeficiency virus HIV uses RNA rather than DNA to encode genetic information. During…

A: Answer: Introduction: The human immunodeficiency viruses (HIV) are the type of a subgroup of…

Q: DNase is an endonuclease that degrades DNA. Which steps or/and reagents in the DNA isolation…

A: Restriction enzymes can be divided into two types viz., restriction endonuclease and restriction…

Q: DNA repair processes use the old DNA strand as the template to repair mismatched bases on the newly…

A: The basis of evolution is mutation. Mutation is also the basis of natural selection. Considerable…

Q: DNA polymerase I, DNA ligase, and topoisomerase I catalyze the formation of phosphodiester bonds.…

A: The DNA replication is a semi-conservative mechanism in which the new complementary strand is…

Q: What are the requirements for strand elongation by DNA polymerase enzymes?

A: DNA replication in eukaryotes occurs in three stages: initiation, elongation, and termination,…

Q: One common type of non-homologous end joining, to repair a double stranded break, occurs when…

A: Introduction  Non-homologous refers to two or more structures or sequences that do not share…

Q: An RNA-dependent DNA polymerase that carries the RNA template with it to synthesize repeats at the…

A: Replication is the process of duplication of the DNA. Replication is initiated by recognizing the…

Q: Describe the d=features of the following DNA-binding domains and how they interact with DNA.…

A: DNA-binding domain abbreviated as DBD is a protein domain that is folded independently and contains…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.