Define what a ligand is. Then give a specific example from class, describing how a ligand acting on its target affects transcription Please answer asap and in short

Q: Discuss any 1 gene regulation mechanism. Describe the gene expression in this type of gene…

A: introduction :  Gene expression is the process of turning genetic information into a functioning…

Q: Define the following terms:a. SRPb. transloconc. docking proteind. SRP receptor proteine. signal…

A: Introduction: Proteins are biomolecules that consist of long chains of amino acids. The structure of…

Q: What is the mechanism by which an RNA transcript can be used to silence expression of the same gene?…

A: Recombinant DNA technology (rDNA technology) is very helpful for analyzing the entire genome of a…

Q: Match each of the following descriptions to the type of regulatory RNA affecting a "target" gene…

A: Of course! Let's break down each match:This regulatory RNA may increase transcription of the target…

Q: Write down transcriptional level control and translation level control. Explain with logic which…

A: Deoxyribonucleic acid, abbreviated as DNA, is a double-helix made-up of nucleic acids. Its role in…

Q: A mutation within a gene sequence changes the start codon to a stop codon. How will this mutation…

A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…

Q: In the Mammalian genome , maximum number of gene code are for which receptors ?

A: Mammalian genome have about 1,00,000 genes and about 100 million nucleotide pairs of coding DNA .

Q: A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho…

A: Transcription is the process of transcribing DNA into mRNA with the help of RNA polymerase. Rho…

Q: Which one is NOT a function of the Signal Recognition Particle (SRP) in protein targeting? 1.…

A: Every cell give a set of compartments meant for protein localization. The transport systems acting…

Q: A particular drug inhibits the protein kinase that is responsible for phosphorylating the CREB…

A: Step 1 CREB- cAMP-response element-binding protein is a cellular translation component that binds to…

Q: Describe the signaling pathway used by a small hydrophobic ligand (like a steroid) to cause a change…

A: A small hydrophobic ligand is a type of signaling molecule that is hydrophobic or nonpolar in…

Q: Describe how specific molecules are used to change the gene expression of a gene in a cell. Explain…

A:

Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: Select the answer that correctly expresses a valid comparison between transcriptional regulation in…

A: Transcriptional regulation is far more complex in eukaryotes than in prokaryotes. Prokaryotic…

Q: Enhancers promoters changing transcription potential insulator sequence translation distant the same…

A: 1. Enhancers can regulate genes from a distance, and yet they influence expression of only some…

Q: (Theme 5) AraC is a transcriptional activator that binds to the AraC binding site and is encoded by…

A: The introduction of arabinose into the bacterial culture serves as a trigger for the activation of…

Q: To create a functional hormone, insulin pre-mRNA is first made during the process of transcription…

A: Proteins are one of most abundant molecules with organic in nature in the living organisms and…

Q: the visual system, it is critical to keep a subset of neuronal genes in a repressed state to…

A: HAT play an important role  in regulations of gene expression. it helps to increase gene…

Q: Below is a list of regulators covered in lecture. For each, identify whether it is cis acting, trans…

A: Understanding Cis-Acting and Trans-Acting Regulatory ElementsIn the regulation of gene expression,…

Q: Complete the sentences about cell signaling using the words and phrases. (Not all words and phrases…

A: The process by which cells interact with other cells in their body or with the outside environment…

Q: What is coactivation? Why do you think it happens?

A: The nervous system is a complex network of specialized cells, tissues, and organs that coordinate…

Q: A.  Which two of the three modes of RNA processing are necessary to increase mRNA stability?   B.…

A: A.) Three major events constitute pre-mRNA processing: (a) 5'-end-capping, (b) splicing, and (c)…

Q: The SecB protein helps export proteins by:

A: In molecular biology, molecular chaperones are proteins that help big proteins or macromolecular…

Q: Give typing answer with explanation and conclusion  In eukaryotes, repressors can function by:…

A: A repressor is a type of regulatory protein that can bind to specific DNA sequences, known as…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: Compare splicing to alternative splicing, focusing on the purpose of alternative splicing, and…

A: Alternative splicing is an alternative splicing process of pre-mRNA during gene expression that…

Q: Consider a gene being transcribed at a constant rate k1 and being degraded with first  order…

A: The genetic information from protein synthesis is stored in DNA. This information is copied onto an…

Q: TATA box during the initiation of transcription in eukaryotes

A: option D is the correct answer. the transcription factor IID ( TFIID) complex binds to the TATA box…

Q: The cell wall is made up of more stable compounds of polysaccharides, which usually in bacteria is.

A: Please post two questions separately.

Q: Explain How can you study protein Z in these cells? (needed)

A: The tumor suppressor gene directs the production of a protein that regulates cell growth during cell…

Q: In humans, miRNAs are thought to regulate the expression of at least one-third of all protein-…

A: RNA (Ribonucleic acid) is a single-stranded nucleic acid that is present in all living cells. It is…

Q: Discuss factors that might influence the activity of DNA-binding proteins (transcription factors)…

A: Transcription is that the process where a gene's DNA sequence is copied (transcribed) into an RNA…

Q: The following diagram depicts the elements at the: Ba cgcc tataan 999 AC ATT BRE TATA box Inr DPE…

A: The diagram depicts  elements at the Promoter  :

Q: Identify the eukaryotic level of gene regulation. Choose the correct answer below. a. Pre-…

A: INTRODUCTION Eukaryotic level of gene regulation include epigenetic, transcriptional, post…

Q: Compare and contrast the activities of an activator protein anda repressor protein.

A: Gene regulation is a mechanism by which cells increase or decrease the productivity of any specific…

Q: cancer-associated kinase.

A: Proto-oncogene tyrosine-protein kinase (Src) is a kind of non-receptor tyrosine kinase protein which…

Q: In this question you are explain in your own words, how RNA interference can be a therapeutic…

A: RNA interference is a biological process where RNA molecules are used to inhibit gene expression.…

Q: For the lac operon, when glucose is absent and lactose is present. CAMP-CAP is bound to the promoter…

A: The lac operon is a genetic regulatory system in bacteria that controls the expression of genes…

Q: Which composition differentiates the plant cell from the animal cell?

A: Please post two questions separately.

Q: Which of the follow general transcription factors contains the protein TBP and binds to TATA box…

A: The correct answer is: a. TFIID TFIID is a general transcription factor that contains the…

Q: Select the incorrect statement: OA Transcription produces an MRNA of a gene that leaves the nucleus.…

A: a. We know that genes or DNA are kept in the nucleus. Ribosomes are present outside the nucleus,…

Q: microRNA DICER RISC [Se PABP Se

A: Post transcriptional gene regulation:The process of controlling of gene expression which occurs…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.