d. You have a 10 gram/ml. stock solution of protein. To make 50mL of 25 mg/ml solution, add, of water to make the final volume stock then add ml.
Q: Choose one biomechanical principle that you will need to keep in mind while performing each exercise…
A: Motion, force, momentum, levers, and balance are the five main elements in biomechanics: Motion is…
Q: Calculate the amount of GFP in grams produced in the 25-L fermentation used to generate cells for…
A: The green fluorescent protein is an autofluorescent recombinant protein extracted from the jellyfish…
Q: If Paige administers Advil at 120 ml/h to a patient, and the drop factor is 8 gtt/ml, calculate the…
A: Body fluids is liquid portion present inside the body . It can be lymph , milk , saliva , blood .…
Q: The goal of this assignment is to introduce you to methods used to determine reliable sources of…
A: A nutritious diet supports normal growth, development, and ageing, helps people maintain a healthy…
Q: describe the potential harm to aquatic organisms of the practice of disposing large amounts of…
A: Detergents are mixtures of water-soluble organic substances/ chemicals that possess cleansing action…
Q: form a phylogentic tree with the following clades: Anaspida…
A: Vertebrata (Crown) / \ Gnathostomata Placodermi / \ / Chondrichthyes Osteichthyes…
Q: What do proteins moving from the ER to the Golgi travel in?
A: Introduction : Endomembrane system includes cell organelles that work in a coordinated way to…
Q: Q: In a certain species of plants, violet flower color (V) is dominant over white flower color (v).…
A: The Hardy-Weinberg Equilibrium presents an equation that may be used to compute allele frequencies…
Q: Which of the following are true about bacterial DNA replication compared to DNA replication in…
A: Replication is a process in which, with the help of DNA polymerase enzyme both the strands get…
Q: 4. The punnett square below shows brown eyed mom and blue eyed dad. Complete the punnett square…
A: Punnett Square is a diagram that displays the possible genotypes of offspring following the…
Q: aternal genotype. Maternal phenotype: Child phenotype: Paternal genotype: Reset A, M, Rh(neg) O, M,…
A:
Q: Which statement is FALSE? O a. Lignin comprises the highest percentage of dry mass of cell wall O b.…
A: A cell wall is an external structural layer that surrounds some types of cells. It may be hard,…
Q: The carbon cycle is nature’s way of reusing carbon atoms, which travel from the atmosphere into…
A: The carbon cycle is a natural process that involves the exchange of carbon between the atmosphere,…
Q: 2. Many health issues have been discussed throughout the semester. Identify a lifestyle choice that…
A: Lifestyle choices play a significant role in determining overall health & well-being. By making…
Q: What macronutrient provides the most calories in this product? b. Is this product considered any…
A: Nutrients are organic molecules necessary for the survival of biological cells. Based on the amounts…
Q: Critical Thinking Questions: 1. Identify the changes in sensitivity that occur in the hypothalamus,…
A: 1. The decrease of sensitivity in hypothalamus and pituitary to negative feedback means that it…
Q: Connective Tissue: Cell Types: (Short Answer Questions) Describe the three (3) types of cells and…
A: Since you've asked multiple questions, we're only answering the first three for you, if you want any…
Q: Peter Singer suggests that we become vegetarian. Do you personally agree with his suggestion or not?…
A: Being Vegetarian means a person who will not eat meat or fish and hence will take only diet of…
Q: ASAP, PLEASE ANSWER ALL THE SUBQUESTIONS TO GET A LIKE. TRUE OR FALSE? Even though steroids have…
A: Even though steroids have different structure compared to triacylglycerols, it is still…
Q: 1) Which sequence represents the correct order of events for the production of necessary complex…
A: The group of chemical processes in organisms that maintain life is known as metabolism. The three…
Q: Craig Venter's group reported sixfold coverage of the H. influenzae Rd genome. Given that the genome…
A: Craig Venter's group was able to sequence the human pathogen Haemophilus influenzae Rd genome with…
Q: What AI can do for medical imaging modalities and how it can improve them
A: Introduction - Artificial Intelligence is a human intelligence simulation by machine. The…
Q: Which of these statements describes an accurate model for how carbon dioxide and oxygen levels…
A: The ocean plays an important role in the global carbon cycle, exchanging carbon dioxide between the…
Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…
A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…
Q: Question 4 Otzi the iceman was thought to have been infected with: 1) Escherichia coli 2) Bacillus…
A: A German tourist named Helmut Simon discovered tzi, commonly known as Iceman, an anciently preserved…
Q: Simplify that answer please
A: Introduction COVID-19 (Coronavirus Disease 19) is a highly infectious respiratory illness caused by…
Q: Draw a small piece of mRNA in the correct location.
A: Genetic information flows from DNA to RNA to proteins. This is also known as the central dogma of…
Q: Match the structure to the description 1. 2. 3. 4. 5. 6. Cerebellum 7. Pineal Gland 8. Thalamus 9.…
A: Sheep brain dissection is a laboratory experiment in which the brain of a sheep is dissected and…
Q: INSTRUCTION: - Answer the question properly - Discuss your answer - Do not copy in Google or here in…
A: Figure 1 depicts the close likeness of Janjucetus hunderi teeth (a-d) and those of the currently…
Q: Which of the following is NOT true about transduction? O The bacteriophage's own viral DNA is the…
A: Bacteriophage transduction is a type of genetic transfer in which bacterial DNA is transmitted from…
Q: What are two advantages of using mice as a model organism rather than yeast?
A: A model organism is a species of plant, animal, or microbe that is widely used as a reference for…
Q: Describe the levels of organisation within the human body
A: The cell is the first level of organisation in the human body. Organs are formed from tissues, which…
Q: Pyruvate to phosphoenolpyruvate conversion reaction could be coupled to reaction for the synthesis…
A: Free energy please a very important roll in deciding whether a reaction will proceed or not. Free…
Q: Explain a way that sensory nervous system transduce stimuli with different strengths using concept…
A: The nervous system is a complex network of nerves and cells that send signals throughout the body.…
Q: A child weighs 11 kilograms. The health care provider orders a drug as follows: 0.2 mg/kg…
A: Drugs can be administered orally, intravenously, intramuscularly, subcutaneously route, rectal,…
Q: According to the endosymbiotic theory, which of the following is NOT true about the evolution of…
A: Because of specialized organelles, eukaryotic cells are more complicated than prokaryotic cells. All…
Q: Determine the scores and profile number for the strip result table shown bellow
A: The identification of the pathogen is important for the proper treatment of a disease. In order…
Q: How does a cell ‘know’ that a protein should move to the endoplasmic reticulum
A: The endoplasmic reticulum (ER), which also performs numerous other critical tasks like folding…
Q: How is a organizational policy created to lessen the outcomes of infectious disease exposures on…
A: Introduction Human health refers to the physical, mental, and social well-being of an individual.…
Q: both parents are recessive short, name the 4 possible offspring.
A: Dominant allele is an allele which is able to express itself even in the presence of alternative…
Q: a. Capacity for Precise Self-Replication and Self-Assembly b. Defined Functions for Each of their…
A: Introduction A species is a group of living organisms that are capable of interbreeding and…
Q: In a 10-month-old child, excessive excitability, sleep disturbances, reduced muscle tone, delayed…
A: The condition of excessive excitability, sleep disturbances, reduced muscle tone and delayed…
Q: Can you explain how chemotaxis proteins work and the process that takes place with them?
A: Chemotaxis is the movement of an organism or entity in response to a chemical stimulus (chemo- +…
Q: Pigeons display a high color variety, here we try to understand the genetic basis of mixed red &…
A: Epistasis means masking the effect of a particular gene type by a different gene. Epistasis is a…
Q: what devices are used biosensors to detect rotten meat
A: INTRODUCTION Biosensors are tools for detecting analytes that combine a biological component with a…
Q: 13. The following chemicals are involved in electron transport. Which of these chemicals has the…
A: 13. The final carrier molecule and the electron grabber is oxygen, which unites them with hydrogen…
Q: ● . If the culture from which you are preparing the slide is a liquid, simply flame your loop, allow…
A: Introduction:- Cells are the basic structural and functional unit of life. Cells are capable of…
Q: Using the figure below for the areas labeled "1" give the name of the axis Yaw and what it controls…
A: The motion of fish has six degrees of freedom because the movement along each of the three axes is…
Q: 1. How are DNA and RNA different from each other? (Select all that apply.) * RNA is more stable than…
A: Planet's life is extremely varied, ranging from simple single-celled protozoa to intricate…
Q: What is shown in the image above? O needle-like leaves that fused O one doubly compound leaf Omany…
A: The image above shows a sample of foliage from a plant. It is composed of several needle-like leaves…
![stock then add
of water to make the final volume
mL
b. You have a 50 mg/mL stock solution of protein. To make 200mL of 2mg/ml solution, add
stock then add
of water to make the final volume
mL.
1
c. You have a 2 gram/mL stock solution of protein. To make 10mL of 10 mg/ml solution, add of
stock then add of water to make the final volume
mL. (HINT: Convert units)
d. You have a 10 gram/mL stock solution of protein. To make 50mL of 25 mg/ml solution, add
stock then add
of water to make the final volume__ ml.
mL
Q
A
2
W
S
#
3
E
D
A
$
4
R
B
%
5
F
I
MacBook Pro
T
•
U
A
6
G
=>
&
Y
7
1
of
8
U
of
J
X
(
1
M](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F485bd773-0327-4e04-9ec2-58e24fd0e5d2%2F56e29469-3a64-4046-9290-561899021fb3%2Fepq6kz_processed.jpeg&w=3840&q=75)
![9. Match the letter of the functional groups to the correct name.
Amino group
Sulfhydryl group
Hydroxyl group
Carboxyl group
Phosphate group
Carbonyl group
B. -OH
D,–NH2
C.
E.
OH
A.
-C-O-P-OH
OH
F.-SH](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F485bd773-0327-4e04-9ec2-58e24fd0e5d2%2F56e29469-3a64-4046-9290-561899021fb3%2Fpnx5y6b_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- o NB4: Why do you think you first had to make the 1 mM solution instead of working directly from the stock solution?An IV bag contains 250 mL of a 5% mannitol solution. How many grams of mannitol are in the IV bag?You had a second solution with an unknown concentration of Protein X that had to be diluted 4x before you could measure the absorbance. The diluted solution had an absorbance of 0.76. What is the concentration of the diluted solution in ug/ml and what is the concentration of the original solution
- 1. Which of the following statement/s is/are TRUE for the protein sample?* The sample will give a positive result to Biuret test. All of A, B and C The sample will give a positive result to Ninhydrin test. The sample will give a positive result to Xanthoproteic test. 2. Extremely high pH causes folding of the protein molecules. * The statement is CORRECT. The statement is INCORRECT. 3.Negative with Biuret Test but positive with Ninhydrin Test, Xanthoproteic Test and Millon’s Test Glycine Tryptophan Tyrosine Methionine AlbuminLook for 5 color reaction/test that can be used to identify amino acids. Indicate also the color for positive results and what causes this results .a) mentioned the name of simple laboratory method to roughly estimate the concentration of anunknown protein
- To set up a standard curve you would have had to set up a dilution series. Draw up a table showing what volume of protein solution and what volume of water you used to set up your tubes assuming you started with a 50 mg/ml stock solution of protein.The folding of some protein was monitored as a function of the time it takes for the protein to fold. Identify the time when all of the protein is native. B Time > O A O E O D OF O B Amount Native >An effort is usually made to purify a protein fırst, before its characteristics are determined. True O False
- Given the information: Tube 6 contains 8.0 g/dLTube 6 contains 0.5 mL of the dilute standard What is the protein concentration of Tube 5 which contains 0.4 mL of the dilute standard? Question 13 options: 4.5 g/dL 6 g/dL 6.4 6.4 g/dLSample A may or may not contain amino acid/s. Based on the two tests performed, Sample D may or may not contain amino acid/s. Based on the two tests parformed, answer the Sample B may or may not contain amino acid/s. Based on the two tests performed, answer the atinne halnw answer the auestions below. auactinne helnw Xanthoproteic Pauly reaction Kanthoproteic Sample A Sample Sample D Mon's Milon's Xanihoproteic Identify the reactive functional group Interpret whether the result for each test is positive or negative for the presence of a certain amino acid. Interpret whether the result for each test is positive or negative for the presence of a certain amino acid. of the amino acid present responsible for the positive result/s. If there is NONE, choose "n/a" 1. Xanthoproteic test JA. Positive ,B Negative) 1. Xanthoproteic testJA. Positive , B Negative) 5. Xanthoproteic test 2. Millen's test (A Poaive B. Negetive) 2. Pauly ReactionA. Positive . 8. Nagative) 6. Millon'sst Identify the…Which of the following about protein denaturation is not trueA. It is always irreversible B. It is a shape change C. It may be due to pH / temperature change D. Most of the proteins denature when transferred from aqueous environment to organs solvents E. Its function is lost.