Draw a small piece of mRNA in the correct location.

Q: Which of the following is not a term used to describe an unspliced mRNA? intronic mRNA O primary…

A: In eukaryotic genes, non coding DNA is also present. In most of the eukaryotic genes, coding…

Q: What happens to the pre-mRNA before it migrates to the cytoplasm? Explain

A: Answer: TRANSCRIPTION : It is the process in central dogma where DNA is transcribed in to RNA by…

Q: DNAT  A  C        C  G  C     T  C  C       G  C  C       G  T  C       G  A  C      A  A  T…

A: The self-replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: DNAT  A  C       C  A  C        C  C  C       C  G  T         A  T  G        G  C  T      G  G  G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: Describe how protein are created in translation. Step by step

A: The translation is the process of protein synthesis.

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: Define recognition sequence.

A: A restriction enzyme or restriction endonuclease is a protein, which can recognize a particular…

Q: what is it called when an mRNA is edited and where does it happen?

A: Commonly it’s known that mRNA is produced during the process of transcription which will then go for…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: For the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons…

A:

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: An mRNA may contain the sequence ATTGACCCCGGTCAA True/False

A: RNA or ribonucleic acid is a polymeric molecule essential in various biological roles in coding,…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: pre mRNA can be spliced in more than one way, permitting a single gene to produce multiple mRNAs…

A: Pre mRNA can be defined as a primary mRNA transcript,which is formed during transcription.This pre…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: DNAT  A  C         C  G  C      C  C  C        A  T  G      A  T  G       A  A  T       A  C  C…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: Describe a technique you would use to identify the location of mRNA in an organism.

A: ANS: Microarray analysis enables researchers to look at expression patterns across all of the genes…

Q: Name and explain the process by which mRNA is formed.

A: Gene expression is the process by which information which is contained in genes is decoded to…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…

A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…

Q: Messenger RNA Iis single-stranded molecule while RNA and rRNA molecules are double-stranded…

A: Ribonucleic acid (RNA) is a biomolecule that takes part in a wide array of biological roles.

Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: Please draw the mature mRNA (before it is ready to be exported from nucleus):

A: In addition to their role in genetic information storage and transmission, nucleic acids are also…

Q: Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop…

A: mRNA or messenger RNA contain the genetic codons that must be translated into amino acid chain…

Q: How does polio (poliovirus) get more than one protein from a single mRNA? Give typing answer with…

A: Polio is an life threatening disease that affects the brain stem or spinal cord and results in…

Q: Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the…

A: The genetic code, which connects the DNA sequence to the amino acid sequence in proteins, is read…

Q: Put the function of mRNA is blank

A: Replication is the process of formation of identical copies of DNA. Transcription is the formation…

Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids. Use…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…

A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…

Q: MRNA build to match the DNA message letter by letter

A: DNA is a double helix with two strands of polynucleotides.