Consider the following polypeptide sequence: Gly Val Tyr Ile Val Asp His Phe Thr Gly Asn Tyr Ala Leu Met Glu Asp Lys Aps Val Val Ala Tyr Glu His Ala Pro Lys Leu Asp Asp Phe Val Glu Glu Ala Ley Lys Val Glu Ala Gly Glu Val Pro Ala Ala Pro A) List the expected fragments that will result from proteolytic degradation with trypsin. B) List the expected fragments that will result from the reaction with CNBr. C) List the first three amino acids that will be identified by Edman degradation in the fragments generated in B).

Consider the following polypeptide sequence: Gly Val Tyr Ile Val Asp His Phe Thr Gly Asn Tyr Ala Leu Met Glu Asp Lys Aps Val Val Ala Tyr Glu His Ala Pro Lys Leu Asp Asp Phe Val Glu Glu Ala Ley Lys Val Glu Ala Gly Glu Val Pro Ala Ala Pro A) List the expected fragments that will result from proteolytic degradation with trypsin. B) List the expected fragments that will result from the reaction with CNBr. C) List the first three amino acids that will be identified by Edman degradation in the fragments generated in B).

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
Identify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’
Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide. I don't understand how the order of amino acids in Step 2 was arranged. Please explain. Thank you.
Treatment of a polypeptide by 2-mercaptoethanol yields two polypeptides that have the following amino acid sequences: Ala-Phe-Cys-Met-Tyr-Cys-Leu-Trp-Cys-Asn Val-Cys-Trp-Val-Ile-Phe-Gly-Cys-Lys Chymotrypsin-catalyzed hydrolysis of the intact polypeptide yields polypeptide fragments with the following amino acid compositions: (Ala, Phe) (Asn, Cys2, Met,Tyr) (Cys, Gly, Lys) (Cys2, Leu,Trp2,Val) (Ile, Phe,Val) Indicate the positions of the disulfide bonds in the original polypeptide.
Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)
Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
Identify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNBR
A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).
A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?
RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
Here is a putative peptide sequence (position number on top of residues): 1 2 3 4 5 6 7 8 9 10 11 12 13 NH2- G C G N V T H N Q C V L S -COOH If expressed in a eukaryotic cell (please mark your answer in the blank space): Position(s) ___ could be N-glycosylated Position(s) ___ could be modified with myristic acid and the bond formed would be a ______________ Position(s) ______and _____ could be modified with palmiti c acid and the bond formed would be a ______________ Positio n(s) ________ could be a segment of a lipid-linked protein with a farnesyl anchor and the bond formed would be a ______________ Position(s) ________ could be a segment of an O-glycosylated protein Position(s) ________ could be modified with a glycosylphosphatidylinositol (GPI) anchor Position(s) ________ could be phosphorylated