Consider Patient 4 and Patient 5.  If patient 4 is female and patient 5 is a male, and they conceive a child together, is there a good chance that the child will have sickle cell anemia (the disease)?   Answer Yes or No

Q: Draw every step involved in the chemical synthesis of the dinucleotide (5')CG(3'). Show molecular…

A: The nucleic acid is a macromolecule that is found in all living organisms and the DNA is a class of…

Q: 3. For a trait caused by a mitochondrial gene variant, there may be females that can transmit…

A: She displays heteroplasmy for its trait and she is the product of somatic mutataion. Heteroplasmy…

Q: II. Problem Solving: Instruction: Using the data on the situation below, compute for the…

A: We are only allowed to do upto three subpart of a question. Please repost the undone question again.…

Q: A. In terms of gene-controlled biochemical pathways, explain the following dihybrid interactions and…

A: A dihybrid cross involves two genes whose interactions and inheritance patterns are studied. In a…

Q: A. The following shows a DNA fragment with a 2. operator. Circled bases make direct contacts with…

A: Answer :  Dms or dimethyl sulphate causes methylation of guanine residues in the dna. This is…

Q: Oncogenes show a of mutation, while tumor suppressor genes show a of mutations. is the process by…

A: Cancer is a group of diseases involving abnormal cell growth with the potential to invade or spread…

Q: 1. To produce a specialized-transducing mycobacteriophage construct, a cosmid bearing the allelic…

A: Cosmids :- These are the vectors, which are constructed by using hybrids of lambda…

Q: Consider the maternal effect gene that controls snail coiling where D = dextral, dominant, d =…

A: Shell coiling in snails can be dextral (coiling with the right hand) or sinistral (left hand…

Q: Describe different experimental approaches based on whether they study HGT outcomes or processes.

A: Organisms like prokaryotes share genetic similarities across species through a process known as…

Q: 4. Which of the following are useful selectable markers (positive or negative)? A) A gene encoding…

A: The gene is defined as the sequence of nucleotides. It is present in DNA. It encodes a protein

Q: A polymer scaffold was designed for skin regeneration. The polymers polyglycolic (PGA) and…

A: a. PGA is one of the most broadly used scaffolding polymers. Because of its enormously hydrophilic…

Q: 13. For DNA, agarose is used as the main chemical to make the gel. What is the purpose of the buffer…

A: Agarose gel  Agarose gel is the polysaccharides which is used in the gel electrophoresis to separate…

Q: 3. The pedigree below was obtained for a rare kidney disease. a) Deduce the inheritance of this…

A: Introduction :  Genetic traits are passed down through inheritance from parents to their offspring,…

Q: Table 1. Comparing Normal With Sickle Mutation DNA This section codes for normal hemoglobin This…

A: Mutations arise at low frequency owing to the chemical instability of purine and pyrimidine bases…

Q: А. В. Generation Ceneration Genan D. E. Generation 1. Which graph above represents the outcome of…

A: Option a) graph which represents the heterozygote advantage. The generation in the first graph is…

Q: Which of the following is the deadliest genotype for the Tay Sachs allele? O t O Tt O TT

A: Tay-Sachs disease or TSD is a lysosomal storage disorder. The cause of this disorder is a mutation…

Q: GENETIC TIPS THE QUESTION: In the Western blot shown here, proteins were extracted from red blood…

A: Step 1 Western blot is a technique that is used to detect specific proteins in a specimen of tissue…

Q: For the creatine kinase shuttle to be effective, the diffusion distance and the rate of ATP…

A: The enzyme creatine kinase is present in the heart, brain, skeletal muscle, and other organs. When…

Q: Problem 6 Short hair in rabbits is governed by a dominant gene (L) and long hair by its recessive…

A: A dihybrid cross is a cross considering two different genes which influence two different observable…

Q: The standard notation for describing the common mutation in the HBB gene that, when homozygous,…

A: Sickle cell anemia is an inherited disorder which affects the formation of hemoglobin and disrupts…

Q: A clinical trial was carried out to test whether a new treatment affects the recovery rate of…

A: A null hypothesis is a statement that presumes no significant difference or relationship exists…

Q: pand ELISA. Write one application.

A: Immunology refers to the body's physical, chemical, and biological responses to external substances.…

Q: Please help! Thanks in advance

A: Hi there! We do not cater opinion based question. Since question 1 is an opinion based question, we…

Q: A dwarf mouse is heterozygous at the Igf2 locus (one Igf2 allele, one Igf2 allele) and has 50% dwarf…

A: A genetic disorder or trait can be passed down from parent to child through gene mutations (changes)…

Q: • Part B a cotransformation experiment, using various mbinations of genes two at a time, the…

A: As you perform an experiment in which another Gene g was studied and it demonstrated positive…

Q: Manic-depressive illness Diabetes mellitus Sickle-cell anemia T-cell leukemia Liver-cell cancer…

A: The reason is that the band labels are the names of diseases and all the diseases listed in the…

Q: Please ASAP. Thank you. The endosymbiosis theory states that the DNA in chloroplasts and…

A: The theory states how does the eukaryote evolve from prokaryotes. The theory supports evolution.

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…

Q: & Compare and contrast the operation of 3-Part differential and 5-Part differential hematology…

A: Introduction  The study of blood and blood diseases is known as haematology. Hematologists and…

Q: Task 1: DNA Extraction To begin work on the bacterium, you begin by extracting its genomic DNA…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Need Help. Describe some genetic disorders caused by chromosomal abnormalities (e.g.,…

A: A genetic disorder is a health problem caused by one or more abnormalities in the genome. It can be…

Q: Same variants appeared in all patients analyzed with low coverage and Phred score (less then 20).…

A: Variants in biology mean difference in genetic makeup of organisms belonging to same species.…

Q: Consider the maternal effect gene that controls snail coiling where D= dextral, dominant,…

A:

Q: The expert seems made a typo. The correct answer should be "(f) sample B has more Ras protein",…

A: Introduction  Based on their size and charge, macromolecules and their fragments can be separated…

Q: Rank these structures by the amount of DNA they include, from least (1) to most (4). + human…

A: Human mitochondrial genome contain 16569 DNA base pairs  Chromatid contain single DNA . Because…

Q: Describe either 1) how you would go about making a goat that produces a silk protein (S) in it's…

A: "Transgenic" is an alternative term used for "genetically modified organisms", these are those…

Q: Why must a discard tube should be collected first before an anticoagulated tube when using a…

A: Venipuncture is the most common method of blood collection. Blood is normally drawn from the medial…

Q: Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the…

A: Sickle-cell anemia is a genetic disease characterized by the sickle shape of the RBCs. It results in…

Q: MICE strip test.  what the result shows, what the result means, your confidence in each result,…

A: Minimum Inhibitory Concentration (MIC) is used to interpret the concentration of a drug needed for…

Q: This activity called DESIGNER GENES. Can you give me another examples of this that are Genetically…

A: Given: Some examples of designer genes.

Q: 8:25 Screenshot_2021120 What I Can Do Activity 6. What is your stand? Directions. Below are some of…

A: A genetically modified organism (GMO) is any organism whose genetic material has been altered using…

Q: What is the typical result of conjugation between one FT cell and one F cell? a. one Hfr cell and…

A: It is the process by which one bacterium transfers genetic material to another through direct…

Q: 6) Consider the maternal effect gene that controls snail coiling where D= dextral, dominant,…

A: The table shown below is a punnet square showing a monohybrid cross between Dd and Dd.   D d D…

Q: Assuming there are colon tumor samples, one from a HNPCC patient, and the other from a FAP patient.…

A: Answer) HNPCC has mostly normal karyotype.   Hereditary Nonpolyposis Colon Cancer (HNPCC):  It is…

Q: You are about to assay for your LDH using LDH reaction cocktail. Your instructor tells you to dilute…

A: Supernatant refers to a clear solution located above the solid residues deposited after certain…

Q: Need help with these questions. What the difference between chromosomes and genes, and how they are…

A: DNA has two important roles in terms of cellular detail. For starters, DNA is the genetic material…

Q: 4. Search up for some common alleles for alpha and beta thalassemia respectively. At which level of…

A: Introduction :- Thalassemia is a genetic disorder that affects the production of hemoglobin, the…

Q: Autosomal recessive hyper IgE syndrome (AR-HIES) is an immunodeficiency disorder. The disorder is…

A: Autosomal Recessive Hyper IgE Syndrome (AR-HIES), also known as Job's syndrome, is a rare…

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.