code, indicate which polypeptides would be synthesized if poly-UGG were used in a s G

Q: Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).

A: These nucleotides are connected by phosphodiester bonds between the 3' carbon of one sugar molecule…

Q: Show tRNAs with their anticodons bound to met and gly codons first without taking wobble into…

A: The discussion at hand centers on the complex and crucial process of translation that occurs in…

Q: Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this…

A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine or…

Q: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3-ТАССТТААСCGTACCAAATGGGCACTACСА-5' 1. Determine the sequence…

A: Since we answer the first question in case of multiple questions. If you want any specific question…

Q: Name the GREEN structure of the tRNA Variable loop D-loop Anticodon loop Pseudouridine loop

A: According to the messenger RNA (mRNA) nucleotide sequence, transfer RNAs (tRNAs), also known as…

Q: Although the Shine–Dalgarno sequences vary considerably in different genes, they include examples…

A: The site of binding of the ribosome in the archaeal and bacterial mRNA is termed as Shine-Dalgarno…

Q: Explain how nucleic acid information is translated into aminoacid sequence and define the role of…

A: The fundamental process of protein synthesis is the formation of a peptide bond between the carboxyl…

Q: Describe what two reaction steps are required for the formation of an aminoacyl-tRNA?

A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that is essential for the production of…

Q: n as1 mutant, assign secondary structure and tell how many alpha helices and beta-pleated sheets…

A: Primary Structure: It is defined as a linear sequence of amino acids joined to each other through a…

Q: Give a possible nucleotide sequence for the template strand of the gene that codes for this…

A: There are four classes of biological macromolecules - nucleic acids, proteins, lipids and…

Q: 5’ - A T G    G C C    C A A    C T G    A C C - 3’ a. How many nucleotides are listed here b. How…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: 5′ - A U G C A A U A C A A U C C G G A A U G A - 3′ Give the primary structure of the protein that…

A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…

Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: In BLOSUM62 matrix, a conserved Tryptophan position has score S(W,W) = 11, but a conserved Leucine…

A: BLOSUM is a block substitution matrix that is used to analyze and identify the best possible…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: The top side of this figure offers more opportunities (for each base pair) that can lead to highly…

A: A single stranded nucleic acid is formed by joining the nucleotide units together through…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: . What is wobble base-pairing? According to Wobble's rule, one tRNA is sufficient to decode the…

A: Base pair is defined as two complementary nitrogenous that are connected by hydrogen bonds. Base…

Q: In the following gel showing stained bands of the Alu insertion sequence, what is the gem of…

A: In the gel, the presence of a band at 941 bp indicates the presence of the Alu insertion sequence,…

Q: The genetic code is both universal and degenerate. Explain how these aspects are an advantage, but…

A: Proteins are made up of amino acids encoded by codons. Each codon consist of three nucleotide which…

Q: The concentration of RNase that Christian Anfinsen used in his denaturation/renaturation experiments…

A: Anfinsen's work demonstrated that the native structure of ribonuclease will form after denaturation…

Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…

A: D.N.A. Cleavage ---  A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…

Q: For the tRNA below, determine which amino acid it is charged with. attached amino acid DD GA G 5'…

A: Several biological molecules in animals are tiny and simple, with just one or a few functional…

Q: HN. `NH NH H2N° A. В. Consider the 3 structures shown. Which of these is (normally) NOT present in…

A: Nucleic acids are the major class of biomolecules that are important for all forms of the organism.…

Q: Draw the syn conformation of purine residues in Z-DNA.

A:

Q: LEU VAL HIS VAL Write the nucleotide sequence of the template strand that corresponds to these…

A: Transcription  Synthesis of mRNA from DNA  Translation Converting genetic information into…

Q: Write a balanced equation for the hydrolytic deamination of a DNA5-methylcytosine residue.

A: 5-Methylcytosine is a methylated form of the DNA base cytosine (C) that regulates gene transcription…

Q: Why is ti advantageous for a cell to expend metabolic energy to polymerize gulucose molecule.?

A: Human blood possesses sugar in the form of glucose, it is being carried to all cells as a source of…

Q: Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000…

A: Introduction :  In mRNA transcripts, introns are referred to as interfering sequences. These are the…

Q: For the anticodon sequences  5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA…

A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…

Q: Identify the secondary structures present in the protein and its genes code…

A: Proteins are large biomolecules that compose structural and motor elements of a cell, and also as…

Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…

A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…

Q: One of the original structures proposed for DNA had all the phosphate groups positioned at the…

A: A structure for nucleic acid has already been proposed by Pauling and Corey. Their model consists of…

Q: explain crucial role of base pairing betweencodon and anticodon

A: The triplet code expresses the hereditary material that is transcribed into messenger RNA (mRNA).…

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.