Classify the following amino acids base on their side chain if it's either  -Non-polar aliphatic R group -Aromatic R groups -Polar uncharged R groups -Positively charged R groups -Polar, uncharged R groups -Negatively charged R groups

Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…

A: Steroids are biologically four ringed organic compounds that act as important components of cell…

Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…

A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…

Q: I. Identify the reactants, enzymes, cofactors/coenzymes and products involved in the glycolysis…

A: The breakdown of glucose to obtain energy is the routine pathway of cells for fulfilling their…

Q: What molecule provides the energy for fatty acid synthesis starting from acetyl-CoA and malonyl-CoA…

A: Fatty acid synthesis is a building up of long chains of fatty acids from 2 carbon units called…

Q: RNA DNA Strand Sugar residue Nitrogenous bases Main Function

A: Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA) are the two types of nucleic acids that…

Q: Question 1 -- / 1 Where does molecular oxygen (O2) get generated during photo-phosphorylation? 1…

A: The plants use light energy to convert CO2 and H2O into sugars and oxygen. So, photosynthesis is the…

Q: How histone and  micro RNA controls gene expressi

A: Histones are positively charged basic proteins that associate with DNA in the nucleus and forms…

Q: In which of the following citric acid cycle reactions does the coenzyme FAD participate?* citrate -…

A: The citric acid cycle (CAC), also called as the TCA cycle (tricarboxylic acid cycle) or the Krebs…

Q: A. They carry unneeded cholesterol back to the body's liver, where it is eliminated. 7. Which…

A: Lipids are amphipathic molecules that contain both polar and non-polar parts present in them. Lipids…

Q: Enzyme X and Enzyme Y both react with the same substrate S. In each reaction with S, 10 µM enzyme is…

A: A substance called an enzyme acts upon a substrate molecule and reduces the amount of activation…

Q: Describe the reaction and the products that would occur if transketolase acred upon a pentose aldose…

A: Transketolase is an enzyme of pentose phosphate pathway which accept two carbon from pentose ketose…

Q: Time left 1:48 37 Please describe the digestion process of proteins in the whole digestive system.…

A: In process of digestion, complex molecules are converted to simple molecules with the…

Q: (1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each…

A: DNA and RNA are polynucleotides. Monomers of nucleic acids are nucleotides. Nucleotides  are made up…

Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…

A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…

Q: alculate the free energy change for glucose entry into cells when the extracellular concentration is…

A: An amount of energy is released in the conversion of reactants to products under standard conditions…

Q: Which of the following statements is correct about oxidative pentose phosphate pathway? Group of…

A: Oxidative pentose phosphate pathway: . This is the first phase in pentose phosphate pathway in which…

Q: What is the direction of transcription in the plasmid shown below? Explain your answer based on the…

A: Transcription is the process of synthesis of RNA using DNA as the template and is catalyzed by

Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…

A: In general, qPCR is beneficial for determining the actual value of a PCR product present at a given…

Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…

A: The solubility of a protein in solution depends on nature of the protein and the concentration of…

Q: What is the dna strand sequence for phosphate sugar backbone?

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: structures of 2 complex lipids (a) a glycolipid and (b) a sphingolipid. Would either of these…

A: Molybdate solution test: First we need to know what is molybdates solution, and how it works?…

Q: Match lipid descriptions in column A with the phospholipid types in column B.…

A: Phospholipids are the important class of lipids with 2 Fatty acids attached to glycerol backbone and…

Q: Cyclic terpenes also contain links that are 1-1, 1-4, or 4-4 True O False

A: There are many types of aromatic compounds found in plants, but many people associate them with…

Q: Explain the process of Drug Elimination

A: Drug elimination is the removal of drug from the body.

Q: The purpose of the carbohydrate in the food industry and its frequency of use

A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, with a…

Q: How does compromised pyruvate kinase activity lead to anemia? (3 sentences)

A: Pyruvate kinase is a glycolysis enzyme that plays a role in the last phase. It catalyzes the…

Q: 9. It is noted recurrent vomiting, weakness, sleepiness, and convulsive attacks, as well, in…

A: The ureotelic organisms are the organisms, which convert the ammonia formed through protein…

Q: If DNA were placed in an organic solvent instead of an aqueous solution, why might the Pauling and…

A: Interactions between 2 chemical (and biochemical) species can be favorable or unfavorable. Favorable…

Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…

A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…

Q: In your own words, what do you think is/are the reason/s why most of the clinical features of these…

A: Krebs cycle disorders are a set of rare human diseases with a remarkable level of complexity when…

Q: CHALLENGE QUESTION I: Smurf hemoglobin has a p50 of 30 torr and has 8 subunits, instead of the usual…

A: Consider the Protein (P) is getting bound by the Ligand (L) to form the Protein-Ligand complex (PL)…

Q: Which statement does NOT describe a general function of the pentose phosphate pathway? Group of…

A: The pentose phosphate (hexose monophosphate shunt) process is more complicated than glycolysis.…

Q: For the electron transport chain, all are inhibitors except: Select one: O a. Antimycin A O b.…

A: Most of the free energy released during the oxidation of glucose to carbon dioxide is retained in…

Q: Which of the following statements regarding the structure of DNA inside cells is NOT correct?   A.…

A: DNA : Double helix  A: Adenine G: Guanine T: Thymine C : Cytosine

Q: Some enzymes can be inhibited by high concentrations of their substrates. I expression for the rate…

A: In the biological systems , enzymes acts as catalysts . Enzyme help to accelerate the reactions.…

Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…

A: The qPCR is generally useful to determine the actual value of PCR product present at provided…

Q: Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest…

A: Ion exchange chromatography is used to separate the charged molecules such as amino acids and…

Q: At which position(s) are amino acids limited to those Which amino acid(s) are more commonly found at…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Create your own timeline form on biochemistry development and its discovery until today

A: Introduction: The study of the molecular basis of life or understanding the life phenomenon in…

Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…

A: Okazaki fragments are short stretches of DNA on the lagging strand, which is synthesized in the…

Q: 2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy-…

A: Chymotrypsin is a protease that cleaves a peptide at the C-terminal of all aromatic amino acid.…

Q: How does the presence or absence of oxygen influence cell

A: Metabolism is the process of extracting cellular energy from the sources like carbohydrate, amino…

Q: Genetically modifying seeds to produce herbicide-resistant plants that increase crop yields has…

A: A Genetically modified technology is formed of insertion of a DNA into the genome of an organism.…

Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…

A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…

Q: What kind of quality assessment is performed on amylase and why is this important? 2. What are the…

A: Amylase  comes under the glycoside hydrolase enzyme family that break down starch into glucose…

Q: Which of the following methods can be used to regulate the activity of cyclin-dependent kinases…

A: CDK are the protein kinase which are involved in the regulation of cell cycle.

Q: 2. In volunteer group starving more than 2 days, blood glucosc concentration reduced till 60 mg/dl.…

A: Glucose is the primary source of energy for the body. When there is no dietary supply of glucose,…

Q: When phospholipids are dispersed in an aqueous solution, they will often form more ordered…

A: The phospholipids are the principle constituents of the cell membrane.

Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…

A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA

Q: Match the following descriptions to the given choices…

A: Vitamin - The organic molecule and an essential micronutrient which is required by any organism  in…