Proteins called molecular chaperones assist in the process of protein folding. One class of chaperones found in organismsfrom bacteria to mammals is heat shock protein 90 (Hsp90). All Hsp90 chaperones contain a 10 amino acid signaturesequence that readily allows identification of these proteins in sequence databases.Two representations of the Hsp90 signature sequence are shown here.Y-x-[NQHD]-[KHR]-[DE]-[IVA]-F-[LM]-R-[ED].4YSNKE/FLRE3.7.11 2 3 4 5 6 7 8 9 10CBits At which position(s) are amino acids limited to thoseWhich amino acid(s) are more commonly found at thewith positively charged side chains?01positions limited to amino acids with positively chargedside chains?O K and RO Y onlyO E only4K onlyD onlyH onlyR only8.OF onlyE and D10

Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

At which position(s) are amino acids limited to those Which amino acid(s) are more commonly found at the with positively charged side chains? positions limited to amino acids with positively charged 01 side chains? 2 OK and R O Y only 4 O E only O K only D only H only R only 8. OF only E and D 10

At which position(s) are amino acids limited to those Which amino acid(s) are more commonly found at the with positively charged side chains? positions limited to amino acids with positively charged 01 side chains? 2 OK and R O Y only 4 O E only O K only D only H only R only 8. OF only E and D 10

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

The OXA-M290 protein is next purified by size exclusion chromatography. To determine the best type of size exclusion resin to use, the size of OXA-M290 must first be determined. Earlier, you determined the amino acid sequence of OXA-M290 (MRVLALSAVFLVASIIGMPAVAKEWQENKSWNAHFTEHKSQGVVVLWNENKQQGFTNNLKRANQAFLPASSAKIPNSLIALDLGVVKDEHQVFKWDGQTRDIATWNRDHNLITAMKYSVVPVYQEFARQIGEARMSKMLHAFDYGNEDISGNVDSFWLDGGIRISATEQISFLRKLYHNKLHVSERSQRIVKQAMLTEANGDYIIRAKTGYDTKIGWWVGWVELDDNVWFFAMNMDMPTSDGLGLRQAITKEVLKQEKIIP). Based on the amino acid sequence, what is the molecular weight of this protein? You can use the free ProtParam tool (https://web.expasy.org/protparam/) to calculate the molecular weights of proteins. Make sure to include units in your answer. Note: The amino acid sequence reported earlier does not include the His-tag that was added to OXA-M290 by the pET-28a vector. However, you do not need to consider the amino acids in the His-tag in your answer to this question. For Context ONLY: For…
Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal determination, a biochemist found out that there are two N-terminal amino acid residues, V and G. What is the original sequence of the protein given the following peptide fragments: after digestion with Chymotrypsin: G-L-S-R-G-M-w V-A-L-F Q-L-Y L-R-V-W G-M-V-E-A-D-I-P K-S-P-E-M-T-W R-M-A-S-E-K-P-G-H after digestion with Trypsin: P-G-H V-W-G-M-V-E-A-D-I-P M-A-S-E-K G-M-W-Q-L-Y-L-R S-P-E-M-T-W-R G-L-S-R V-A-L-F-K after digestion with Cyanogen Bromide: T-W-R-M W-Q-L-Y-L-R-V-W-G-M V-E-A-D-I-P A-S-E-K-P-G-H V-A-L-F-K-S-P-E-M G-L-S-R-G-M
Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…
The sequence of a 29 aa long peptide can be determined from the following data: Treatment of the peptide with dansyl chloride reveals that the amino-terminal is Val. Trypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: T-1 V-G-A-H-A-G-E-Y-G-A-E-A-T-E T-2 A-A-W-G-KT-3 V-L-S-P-A-K T-4 T-N-V-K
Suppose that there is a protein consisting of two polypeptide chains with the given sequences in the picture. Before performing Edman sequencing method, it is required to identify the protein's amino acid composition first. Explain why it is required to do the said step first before doing Edman sequencing method.
A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?
A sample of an unknown peptide was dividedinto two aliquots. One aliquot was treated with trypsin; the otherwas treated with cyanogen bromide. Given the following sequences(N-terminal to C-terminal) of the resulting fragments, deduce thesequence of the original peptide.
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?
Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick base pairing to the complementary PNA sequence (Cterminus-TC-Nterminus). Make sure to include both the sugar phosphate backbone of your DNA sequence, as well as the peptide backbone of your PNA sequence. DNA: 5’-AG-3’ PNA: (C)-TC-(N)
Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are negatively charged (e.g., glutamateand aspartate), some are polar but uncharged, and some are nonpolar.If you knew that a DNA-binding protein was recognizingthe DNA backbone rather than a base sequence, which aminoacids in the protein would be good candidates for interacting withthe DNA?
Like a helices, ß sheets often have one side facing the surface of the protein and one side facing the interior, giving rise to an amphiphilic sheet with one hydrophobic surface and one hydrophilic surface. From the sequences listed below, pick the one that could form a strand in an amphiphilic ß sheet. O TLNISFQMELDV O DSETKNAVFLIL O VLEFMDIASVLD
Shown in the following table are several amino acid substitutionsin the a and b chains of human hemoglobin. determine how many of them can occur as a result of a single nucleotide change.