Check for understanding-Fronts Seattle Boston Chicago San Diego Tulsa Warm front Cold front From the map above, you can predict that the weather in Tulsa is not changing. This is because of a cold front stationary front 1 3 4 warm front 9.

Q: Read the article here challenges that blomes, and those organisms that live within them will face in…

A: The three major changes that will occur over the next 80 years are as follows -  1. Stress or…

Q: Please I need help understanding this question

A: Digestive system is part of body system that play chief role in the breaking up of food material…

Q: Except for the following státements about blood are true.

A: Blood is the main circulatory fluid in our body. Functions of blood:- 1)To carry oxygen from the…

Q: Q1.32. In the terrestrial phosphorus cycle illustrated below, at what rate is the size of the plant…

A: Phosphorous is introduced into soil by the weathering of rocks. The soluble phosphorous is then…

Q: The study of biology includes things that were once living and those alive today. O True O False

A: This statement is TRUE.

Q: Which of the following sequences would be complementary to a DNA strand with the sequence…

A: Complementarity refers to a relationship between two structures each following lock and key…

Q: 7. The PCV test determines the ratio of volume to total blood volume. ? is an oxygen-carrying…

A: Blood is the fluid in the body that transports oxygen and nutrients to the cells while also…

Q: ents the biochemical reaction that occurs durin

A: Introduction:-  DNA synthesis is the biological process by which a deoxyribonucleic acid(DNA)…

Q: Which of the following is/are true about the signal recognition particle (SRP). Choose all that…

A: SRP is defined as the signal Receptor Protein that is a ribonucleoprotein particle and helps in…

Q: Please I need help understanding this question

A: In Human body , there are two types of glands:-  A ) Exocrine gland  B ) Endocrine gland  Exocrine…

Q: 6. How many males are affected by this gene? a 2 3 d. 7. Use the same pedigree as the question…

A: When analyzing any population with minimal progeny data from several generations, pedigree…

Q: Which level(s) of protein structure can you find the a helix and the B pleated sheet? CHECK ALL THAT…

A: Introduction:- A protein molecule is much larger than a sugar or salt molecule, and it is made up of…

Q: For which set of fitnesses is one of the alleles additive and beneficial? WAA = 1, WAB = 1.2, WBB =…

A: Polygenic traits lead to additive alleles, that indicates that multiple genes encode for the…

Q: Please I need help understanding this question

A: RBCs or red blood cells are also known as erythrocytes, red cells, or red blood corpuscles. They…

Q: Consider a locus with two alleles and fitnesses WAA = 1, WAB = 1, WBB = 1. The initial %3D frequency…

A: How can an allele be fixed in a population.

Q: Why are hydrocarbons insoluble in water? O They are lighter than water. O They are hydrophilic. The…

A: Hydrocarbons are organic molecules are made up of hydrogen and carbon. The long chains of carbon are…

Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…

A: According to Bartleby guidelines, the first three subparts have been answered kindly post the…

Q: Some antacid drugs block histamine receptors and result in reduction of the production and excretion…

A: The digestive system comprises the organs that help in digesting the food, absorption of nutrients…

Q: Please I need help understanding this question

A: The organ system of the human body through which exchange of gases occurs between the body and…

Q: Which one of the following answer choices shows the correct pairing of complementary nitrogenous…

A: DNA is a double helical molecule made up of two strands coiled around each other.  Each strand of…

Q: Part 4: Model Evaluation In science, models are used to represent explanations and predictions. The…

A: Introduction FOOD CHAIN:- It is the food connection between organisms who are dependent on each…

Q: Please I need help understanding this question

A: Hormones are biomolecules that are synthesized at a place and worked in another place most of the…

Q: You recently got strep throat, caused by streptococcal bacteria. You took antibiotics, and your…

A: Introduction :- Streptococcus is a genus of Gram-positive bacteria that can cause a wide range of…

Q: 9. How could an asteroid impact kill off so many different species? Select one response. O a. Debris…

A: A asteroid is a large piece of rocky particle that orbit around the sun.Sometimes it collides with a…

Q: 1. A single bacterium is placed in a bottle full of nutrients at 11 A.M. The number of bacteria…

A: 1- a )  11.59 1-b) at  11.58   bottle will be half filled with bacteria. 2) current world population…

Q: For inspiration to occur, which of the following has to happen first? O thoracic cavity volume…

A: The process of taking air into the lungs and throwing it out is known as breathing. The exchange of…

Q: Functions of the large intestine include O reabsorption of water and compaction of feces. most of…

A: The digestive system help in the break down of the food substances into the body. This system has…

Q: The electron transport chain (ETC), or respiratory chain, is linked to proton movement and ATP synt…

A: Introduction: The electron transport chain is the movement of electrons from NADH and FADH2 to…

Q: nes smaller.

A: A flock of Darwin finches migrate to an island where seeds are large. Finches adapt themselves and…

Q: 3. Wild animals placed in zoos sometim result from a(n) _ in the anir O decrease; cortisol O…

A: Because the animals are well fed yet get a very little exercise in their cramped enclosures, many of…

Q: Dying cell with secretory vesicles How much is destroyed? [Select ] Name v [Select Apocrine gland…

A: Introduction: The exocrine glands release their secretions through a duct that mediates the…

Q: need help finding the right answers  there are mutiple answers please

A: In a coelomate, the lining of GI is different from the lining of internal organs and hence the first…

Q: Please I need help understanding this question

A: Blood is the fluid connective tissue of the body. the blood contains several types of cells as well…

Q: QUESTION 1 A dehydration reaction between 2 glucose molecules results in the formation of: 4 simple…

A: Dehydration synthesis reaction: is a reaction which involve formation of new compounds by…

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…

Q: All the following is true of CO poisoning éxcépt CO is an odorless gas O CO has higher affinity to…

A: Carbon Monoxide when breathed binds to the haemoglobin so strongly that it doesn't let oxygen bind…

Q: How many alleles do living things have for each gene? Type a number into the blank. 2

A: Allele : Allele is one of two or more forms of gene that arise from mutation present in the…

Q: а ТЕМ.

A: cell biologist or researchers are examine cells and magnify organelles and track cells as they…

Q: 5a. Blood Type--Multiple Alleles Blood type in humans is a trait that is controlled by multiple…

A: Blood is a liquid substance which flows in the blood vessels and carry nutrients and oxygen to the…

Q: 1-4 Answer 0 White Fur in a recessive trait (F) while. brown Fur is the completely dominant trait…

A: According to Hardy-weingberg law "In absence of forces that change gene frequences, relative…

Q: Please I need help understanding this question

A: The endocrine system is the ductless system that secretes its secretions directly into the…

Q: Please I need help understanding this question

A: Protein is an amino acid-based macromolecule that plays a crucial role in the body. Carbon,…

Q: Two hormones that have opposing effects are called

A: Hormones are chemical substances that carry information from the place of their production to the…

Q: Consider the Ramachandran plot to answer both questions. Which observation most likely describes…

A: The proteins are polypeptide chains of amino acids. These amino acids are packed into protein…

Q: A person with a type B+ blood type can safely receive blood from all of these donors except

A: The Landsteiner grouping has four blood groups namely A,B,AB,O. The Rhesus factor was discovered…

Q: Please I need help understanding this question

A: Blood is basically a connective tissue in fluid form. It is called the fluid of life as it carries…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: The given strand represents the complimentary strand of DNA. The complimentary strand. Given the…