Chaperone proteins interact with the polypeptide sequence formed in translation. How might a mutant chaperone protein be responsible for a genetic disorder involving an enzyme? The poly a tail may be too short. O It might cause the promoter to be misread. The polypeptide may be folded incorrectly. It might form an incorrect amino acid sequence. O It may cause an epigenetic change such a methylation.

Q: What is the name given to study of biochemical nature of genes and how genes express their encoded…

A: Genes are the sequence of nucleotide bases present in the DNA in a cell. There are many genes in the…

Q: Label the diagram to explain how the ncRNA HOTAIR plays a role in gene expression. Nearby histones…

A: A long non-coding RNA (nc RNA) molecule is HOTAIR (HOX Transcript Antisense Intergenic RNA). A type…

Q: Select the processes that only happen inside the nucleus of a eukaryotic cell. Select all that…

A: Eukaryotic cells make up the eukaryotic body. These are more advanced organisms because their…

Q: Self-bonded and looped sequences near the end of single poly-ribonucleotide chains control gene…

A: Gene is the sequence of nucleotide that encodes a specific protein.

Q: Which of the following statements about "Focused transcription initiation", "Dispersed transcription…

A: Transcription is the process by which the DNA sequence is "transcribed" into RNA sequence. It is the…

Q: Discuss how the expression of a protein can be regulated post transcription in eukaryotic cells…

A: The eukaryotic cell after transcription called the primary transcript is not considered as messenger…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Mutations outside of the coding region of a gene can have an effect on the expression of the gene.…

A: Mutations can be defined as a change in nucleotide sequences. It can occur either due to error…

Q: Transcription is thus the final stage of gene expression involves interactions between three types…

A: Transcription is copying down of information from DNA to RNA. The final stage that involves gene…

Q: Which of the following corresponds to the three basic components of a mononucleotide? O Phosphate…

A: The Nucleotides are building blocks, of DNA and RNA and DNA and RNA molecules are polymers made of…

Q: The chain elongation in transcription continues until a termination sequence is encountered a stop…

A: In transcription , a special sequence contains U rich sequence downstream from a stretch of…

Q: The addition or deletion of methyl and acetyl groups to regulate transcription Proteins that…

A: Answer. Transcription is a process of formation of transcript (RNA). It takes place by the usual…

Q: What is meant by the term attenuation? Is it an example of generegulation during transcription or…

A: Attenuation --Definition -- Attenuation is term has different meanings in genetics , microbiology…

Q: The sequence: ATTGCCGACGACTTG is complementary to a sequence that is used as a template in…

A: (-) Sense

Q: What would happen if any of the stages involved in the translation of DNA to protein were…

A: Translation is a process in which ribosomes synthesizes the proteins in Cytoplasm after the…

Q: Select all the possible mutation types for the following observed phenotype resulting from a…

A: Need to find which of the following mutation is happened in protein to express in wrong cell

Q: Which of the following statements best describes the effect a nonsense mutation within a gene's…

A: Mutations are the sudden change in the DNA sequence which most likely alters the amino acids encoded…

Q: What do the promoters of nearly all eukaryotic genes contain?

A: Promoter is a region in a gene where enhancer binds and transcription of gene starts.     TATA…

Q: Which of the following mechanisms do prokaryotes use to produce different prdtein products from a…

A: In prokaryotes, the genes encoding proteins of related functions are transcribed under the control…

Q: 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP…

A: Transcription is the process of formation of mRNA from DNA template strands by an enzyme called RNA…

Q: Transcriptional termination generally will include the transcription of an inverted repeat in that…

A: Transcription is the process by which the information in DNA is transcribed onto the mRNA molecule…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: Concentration (%) A researcher is studying environmental conditions that cause the expression of…

A: We analyze the correlation between pH values and active repressor concentration to identify the…

Q: Explain how each of the following processes complicates the concept of colinearity. Q.…

A: Colinearity takes place when the sequence of amino acids in the polypeptide determines the sequences…

Q: What are the details of the epigenetic processes involved in gene regulation of Histone…

A: Epigenetic processes assume significant parts in quality guideline by changing histones and DNA,…

Q: Introns are intervening sequences; what are exons?

A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…

Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…

A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…

Q: What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription…

A: Elongation Factor Thermo Unstable (EF-Tu) is one of the most prevalent proteins in bacteria, making…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: The following diagram depicts the elements at the: Ba cgcc tataan 999 AC ATT BRE TATA box Inr DPE…

A: The diagram depicts  elements at the Promoter  :

Q: From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to…

A: Regulatory proteins are any protein that affects the sections of a DNA molecule that RNA polymerase…

Q: After the entire coding sequence of a protein has been decoded and the peptide chain is synthesized,…

A: Translation is a process of protein synthesis. It is completed in three steps-  Initiation…

Q: Which of the follow general transcription factors contains the protein TBP and binds to TATA box…

A: The correct answer is: a. TFIID TFIID is a general transcription factor that contains the…

Q: What is NOT true about the function of RNA polymerase? O its rate of activity is similar for all the…

A: Promoter sites are short DNA sequences found in the promoter region of a gene. They act as binding…

Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’   An…

A:

Q: Which of the following would not be the consequence of alternative splicing? Two genes to express…

A: Alternative splicing is the method of producing differentially spliced mRNAs by choosing alternative…

Q: What is the mechanism for addition of a guanosine to create the 5' methyl cap of a MRNA? O The 5'-OH…

A: Mature mRNA is an mRNA that is modified post-transcriptionally. Mature mRNA carries information from…

Q: Which of the following scenario will result in greater consequences in terms of gene expression?…

A: Gene expression is basically the process in which the gene (contained typically in a DNA) is…

Q: Which of the following is a method through which cells can control their gene expression?…

A: Cells control gene expression to control the structure and functions which they exhibit.  There are…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.