Caspases are involved in ___. Select one: a. protein dephosphorylation b. programmed cell death c. cell division d. redox status of proteins e. protein synthesis

Q: for question 1, choose wheater each choice is either tumor suppressor or proto oncogene\ for…

A: Proto-oncogenes and tumor suppressor genes are two types of genes that play important roles in the…

Q: The first step in the action of a growth factor isa. histone unwinding.b. binding to cell surface…

A: Answer is b.) binding to cell surface receptors.

Q: Complete the following statements by selecting one of the two options provided. A mutation that…

A: Introduction  Mutation is a change in the DNA sequence of an organism's genome. These changes can…

Q: targeting a protein for the ER

A: The production of proteins for getting into the endoplasmic reticulum (ER) is started on the free…

Q: Select the best explanation of the unfolded protein response (UPR): O A. The UPR senses misfolded…

A: When the protein is completely formed it is folded accordingly yo form a biologically active protein…

Q: When bacteria are grown in the presence of high concentrations of tryptophan: O A. A repressor is…

A: Tryptophan is defined as an alpha-amino acid utilized in the biosynthesis of proteins and cannot be…

Q: What would be the effect on the cell cycle if a cell acquired a mutation that rendered each of the…

A: The cell cycle is a series of events that take place in a cell as it grows and divides. A cell…

Q: Retroviruses such as HIV, Herpesviruses, and Hepatitis B can be effectively inhibited by _____. Mark…

A: Nucleoside analogs such as acyclovir are antiviral drugs that can effectively inhibit the…

Q: Match the following proteins to their functions ✓ Cathepsins ✓ Calpains ✓ Granzyme B ✓ Apoptosis…

A: Introduction A rectilinear chain of amino acids joined by peptide bonds constitutes a protein.…

Q: Which of the following elements may be in the transduction part of cell signaling? Select one: a.…

A: Ans: Signal transduction: The process of transporting signal from cells exterior to the internal is…

Q: Caspases are involved in ______________. Select one: a. promoting the cell cycle b. promoting cell…

A: Caspases are cysteine dependent proteases. They help in cell death.

Q: Please answer problem #3

A: Ligand is a substance that forms a complex with a biomolecule to serve a biological function. In…

Q: 14)How does a compound that inhibits the GTPase activity of ras affect cell responses to growth…

A: Ras's GTPase activity is essential for controlling how cells react to growth stimuli. Ras is a tiny…

Q: 6) The functioning of the "Ras/MAPK" signal transduction pathway is absolutely essential in order…

A: Targeted therapy is a type of cancer treatment that targets proteins that control how cancer cells…

Q: How machinery of gene regulation is controlled by cell signaling?

A: Cell signaling is a process, during which extracellular ligand molecules get binds to the receptor…

Q: which condition a trimeric G protein is activated by a cell-surface receptor, a. the a subunit…

A: The answer to this question is given below,

Q: Select from the drop-down menu which type of regulation is occurring in each case. The Ixb12 gene…

A: Gene regulation is a mechanism of controlling the function of gene and it's associated mRNA and…

Q: A mutated form of protein p5x is found in patients with squamous cell carcinoma. In vitro studies…

A: A gene that produces a protein that is essential for regulating cell division and death and is…

Q: Certain types of cancerous lung tumors can secrete hormones normally made by the pancreas, adrenal…

A: Lung neoplasms are a form of cancer that occurs in the lung cells most likely in individuals who…

Q: c) The signal recognition particle (SRP) plays an important role in bringing proteins to the ER.…

A: (a) Protein A is the transmembrane protein. Transmembrane proteins are the proteins which are…

Q: The Bax protein, thus Select one: apoptosis. a. none of the above b. inhibits caspase activity,…

A: Introduction :  All multicellular organisms, including plants and animals, go through the…

Q: This molecule is most likely implicated in the renaturation of proteins. Select one: a. chaperone…

A: It refers to the process of refolding a protein structure. Renaturation is the opposite of Protein…

Q: The antagonist of the inhibitor in down regulation is called: A. repressor B. promoter C. inducer D.…

A: explanation-An decrease in the number of receptors on the surface of target cells making the cells…

Q: Scientists have identified overexpression of Na+/K+ ATPases in several types of cancers plorectal…

A: It is given that we have to design a drug which is preventing the overexpression of the Na+/K+…

Q: During apoptosis, rates of protein degradation activity. Select one: a. decrease, decrease b.…

A: Apoptosis is a process of cell death that is mediated by proteases. Proteases are enzymes that…

Q: You are looking at the results of a western blot from the lysates of cells harvested from a…

A: When you observe an increased expression of INK4-p16 in the lysates of cells harvested from a…

Q: Please explain correct answer

A: Apoptosis is an energy dependent genetically programmed process which occurs during embryogenesis,…

Q: Which of the following defects in RAS would be tumorigenic? multiple answers    A. Deletion of…

A: Ras is a nucleotide binding protein that is responsible for cell division, growth and…

Q: You are in a research lab studying the function of the mutated form of a receptor called Protein X,…

A: Protein X can be the Thyroid hormone receptor. The correct option is d.  Thyroid hormone is…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: lease solve parts E and F

A: Ans E:- The regulation of formation and destruction of cyclins occur at following levels:-…

Q: Explain How can you study protein Z in these cells? (needed)

A: The tumor suppressor gene directs the production of a protein that regulates cell growth during cell…

Q: Identify which of the following statements is a lie? Select one: a. A signalling pathway called…

A: Cell signalling or cell communication is the capability of the cells to communicate with each other…

Q: A particular tumor cell has a mutation that makes MAPKKK hyperactive, leading to constitutive cell…

A: MAPKKK protein is a part of ras signaling which is as follows  receptor kinase activation --> Ras…

Q: This phosphatase removes an inhibitory phosphotyrosine phosphate from serine protein kinase,…

A: For cell proliferation and cell growth, cell division occurs. A cell undergoes a cell cycle before…

Q: The NFAT family is a ubiquitous family of transcription factors. a. Under resting conditions, where…

A: a. Under resting conditions, NFAT (Nuclear Factor of Activated T cells) is phosphorylated and…

Q: Identify which of the following statements is a lie? Select one: a. Protein kinase C can add a…

A:

Q: You are a scientist studying drug resistance in cancer. You are particularly interested in ABCB1, a…

A: Cancer causes the uncontrolled growth of abnormal cells and dynamic altering in the genome. Common…

Q: cancer-associated kinase.

A: Proto-oncogene tyrosine-protein kinase (Src) is a kind of non-receptor tyrosine kinase protein which…

Q: Vinblastine is a standard chemotherapeutic drug used to treat cancer. Because it interferes with the…

A: There are a few important points : Abnormal proliferation of cells without differentiation and…