Calculate the physiological free energy for the substrate level generation of ATP from PEP catalyzed by the enzyme Pyruvate Kinase: Phosphoenolpyruvate + ADP --> Pyruvate + ATP at 37C in a red blood cell where {PEP]=4.7mM. [pyruvate]=1.0mM. [ADP] = 0.73mM and [ATP] = 2.6 mM The standard free energies of hydrolysis are: PEP--> pyruvate +Pi: -61.9 kJ/mol ATP --> ADP+ Pi: -30.5 kJ/mole Report to 1 decimal as kJ/mol
Q: ヨ LL F A B C D Match the letters to the appropriate terms to complete the sentences. Terms can be…
A: Ideal Environment for Animal Cells: IsotonicExplanation: In an isotonic environment, the…
Q: define promotor sequences in transcription?
A: In the context of biology, transcription is the process by which the information in a strand of DNA…
Q: Moths Genotype Color Moths Released Initial Frequency Frequency Gs Number of Moths Gs q2 Typica dd…
A: The image you provided shows a table related to a moth population in a polluted forest environment.…
Q: What is a good response to? For my review of the El Paso Community Health Needs Assessment (CHA)…
A: References: Centers for Disease Control and Prevention. (2020). Overweight & Obesity. Retrieved…
Q: None
A: The provided diagram represents an mRNA molecule transcribed from an operon, a typical feature in…
Q: Answer the following question using the provided textbook link:…
A: Approach to solving the question:Discussed brieflyDetailed explanation: Examples: Key references:
Q: Do not use Ai.
A: (A.)Step 1: Understanding the Enzymes InvolvedPhosphofructokinase (PFK) is a key enzyme in…
Q: what is a good response to this answer? I selected influenza for my portfolio project. The United…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: None
A: An adaptive allele has a higher chance of disappearing or being lost in a population with a small…
Q: In an Australian outback, kangaroos feed on grasses and shrubs. The overpopulation of kangaroos can…
A: Approach to solving the question:In the above scenario, Dingos, the top predators are keystone…
Q: A friend of the family is very upset because she feels that her grandmother was not properly treated…
A: The first potential health care issue is the lack of information provided about the grandmother's…
Q: Answer A, B, C
A: A) Epidermis.=> Epidermis is the outermost layer of the skin. B) Sebaceous gland.=> Sebaceous…
Q: A critical feature of the plasma membrane is that it is selectively permeable. This allows the…
A: Selective Permeability of the Plasma MembraneThe plasma membrane's selective permeability is a…
Q: What effect typically prevents individuals from cheating because they are being observed by others?…
A: The "watching eyes effect," or multiple eyes effect draws attention to the psychological effects of…
Q: This is corn that was stored in animal feed mill warehouse that lost power and cooling for 10 days…
A: Approach to solving the question: / Detailed explanation / Examples: Aflatoxins are a group of…
Q: What is the number one way to decrease global warming Group of answer choices: Blast cold air into…
A: To provide what is best and to understand more about the students concerns for their studies.
Q: Which of the following types of glands/ducts are always related to a hair follicle? A) Apoeccrine B)…
A: In the human body, there are several types of glands that perform various functions. These include…
Q: onohybrid Crosses: X-Linked Recessive Traits 8. Red-green colorblindness is an X-linked recessive…
A: We will assume that the normal allele is represented by C while the mutant allele (recessive allele)…
Q: Despite the introduction of many pest-resistant GM crops using molecular biolog and resistant genes,…
A: From 2000 to 2011, it was anticipated that the advent and broad acceptance of genetically modified…
Q: None
A: The two hemispheres remain connected through the corpus callosum. This helps them in communicating…
Q: None
A: Humoral immunity is a subtype of sorts to the adaptive immune system that is centered on the…
Q: None
A: To calculate WACC, we need to find the cost of debt, cost of preferred stock, cost of common stock,…
Q: Part I: Multiple choice: Circle the letter that bears the correct answer no erasing 1. The beatin of…
A: 1) - In sponges sexual reproduction takes place in the mesohyl. 2) - Flatworms are members of a…
Q: Assignment 9: Transcribing and Translating a Protein Activity 5.4.1 Synthesis of a Protein: A…
A: 1. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence…
Q: Here is a pedigree from a family with a high prevalence of breast cancer. dx means the age at…
A: Step 1:Step 2:
Q: introduced to the concept of walkability and the impact that environmental pollution can have on…
A: First, visit the Walkscore website and enter the name of your community or a specific address. The…
Q: Worksheet-DNA 2D, synthesis and 3D With this non-graded worksheet, you will put in practice the…
A: Let's break down the worksheet step by step with detailed explanations for each part. 1. DNA 2D,…
Q: A lake that was once clear and supported a diverse aquatic plant community becomes eutrophic due to…
A: Understanding the Lake's Shift: A Detailed Exploration1. Background: The Initial ConditionInitially,…
Q: Please explain answers well as this is practice e
A: Question 4 The figure plots various trees with respect to their lignin to nitrogen ratio and…
Q: using actin and mysosin filaments, show a picture of a contracted muscle fiber cell with the…
A: The image appears to depict various components related to muscle contraction, including actin and…
Q: how does birth control affect a woman's health?
A: Birth control, also known as contraception, is a method or device used to prevent pregnancy. It can…
Q: Please Answer for each
A: Allelopathy is the biological phenomena wherein an organism produces biochemicals into the…
Q: chemistry What properties of iron account for its extensive use in terrestrial biological reactions?…
A: ### Iron in Terrestrial Biological ReactionsIron is extensively used in terrestrial biological…
Q: None
A: Peptidoglycan, also known as murein, is a vital component of the bacterial cell wall that provides…
Q: None
A: Let's address those questions little by little based on the facts and statistics furnished inside…
Q: Student question Walk through every step that is involved in generating acetyl CoA from Pyruvate 1.…
A:
Q: D Question 8 2 pts Give the single letter translation for the protein encoded by this mRNA. Start…
A: The first step in translating mRNA into a protein sequence is to identify the start codon. In…
Q: None
A: Making an RNA strand that is complementary to the DNA template strand is called Transcription. Note:…
Q: which of the following is correct regarding prokaryotic cells? a. they all contain ribosomes b.…
A: Prokaryotic cells are the simplest and most ancient forms of life on earth. They are characterized…
Q: microbiology question, Briefly compare horizontal and vertical gene Transfer?
A: In biology, gene transfer refers to the movement of genetic material from one organism to another…
Q: What is your content about the topic respiratory system
A: The respiratory system is essential for gas exchange, providing oxygen to the body and removing…
Q: 4 Part A Ephedrine is a protein extracted from a Chinese plant that acts similarly to epinephrine…
A: Other incorrect options:Increased digestive functions: Ephedrine and epinephrine are part of the…
Q: None
A: The human heart has four chamber two atrium and two ventricle. The heart receives deoxygenated blood…
Q: Place the labels in the correct column for Eukaryotic transcriptional termination
A: In the Allosteric Model, the termination of transcription is driven by conformational changes in RNA…
Q: A group of wildebeests moves across the savanna in a large-scale, seasonal journey following the…
A: Step 1: Define the choices given (in the simplest terms)*Dispersion -> movement of animals in…
Q: Phospholipids form the main fabric of the plasma membrane. One feature of phospholipids is that when…
A: Step 1: The Hydrophilic describes substances or surfaces that have an affinity or attraction to…
Q: Think 2 questions about evolution that you have but which Darwin, Wallace, and Mendel did not…
A: Here are two questions about evolution that neither Darwin, Wallace, nor Mendel fully addressed, but…
Q: True or false? A person's perception of risk and their own values or beliefs can impact how they…
A: The statement is suggesting that a person's perception of risk, their values, and beliefs can…
Q: ☐ 17. (07.08 MC) The prairie chicken was once widely seen in many areas across the Great Plains. Due…
A: Option a: This option is correct. Option b: This option is correct or incorrect because Option c:…
Q: Which of the following is not a possible reason for the reduction in measles deaths in the U.K in…
A: Approach to Solving the Question: To solve this question, I need to consider the common factors that…
Step by step
Solved in 2 steps
- The following two reactions are coupled in the last step of glycolysis (catalyzed by the enzyme pyruvate kinase). РЕР + Н.О € Руr + Pi ADP + Pi → ATP + H2O AG° = -14.8 kcal/mol AG° = +7.3 kcal/mol D) The steady-state concentrations of ATP, ADP, and pyruvate in human erythrocytes are 2.24 mM, 0.25 mM, and 0.051 mM, respectively. What would be the concentration of PEP in these cells if the coupled reaction was at equilibrium?The phosphorylation and oxidative decarboxylation of oxaloacetate by inorganic phosphate (Pi) to make phosphoenolpyruvate and carbon dioxide is endergonic under intracellular conditions. It is characterized by this equation: Oxaloacetate + Pi ←→ Phosphoenolpyruvate + H2O + CO2 ΔG’ = +24.6 kJ/mol The synthesis of GTP from GDP and inorganic phosphate (Pi) in solution is endergonic under intracellular conditions, and it is characterized by this equation: GDP + Pi ←→ GTP + H2O ΔG’ = +30.5 kJ/mol Write a new net thermodynamically coupled reaction equation that describes the synthesis of phosphoenolpyruvate from oxaloacetate using the hydrolysis of GTP to power the reaction and calculate the new net ΔG’ of this reaction. Show all of your work.Imagine a triglyceride comprised of (3) saturated C12 fatty acids. Calculate the number of ATP generated from the complete oxidation of one of these 12-carbon fatty acids to CO2 and water in the liver. Assume that each NADH = 2.5 ATP and each FADH2 = ETC generates 1.5 ATP. Any step that yields pyrophosphate as a product should be treated as an input (i.e. net loss) of (2) ATP.
- Intracellular concentrations in resting muscle are as follows: fructose- 6-phosphate, 1.0 mM; fructose-1,6-bisphosphate, 10 mM; AMP, 0.1 mM; ADP, 0.5 mM; ATP, 5 mM; and P, 10 mM. Is the phosphofructokinase reac- tion in muscle more or less exergonic than under standard conditions? By how much?Aconitase catalyzes the reaction: citrate ↔ HisocitrateThe standard free energy change, ΔG°′, for this reaction is +6.3 kJ/mol.However, the observed free energy change (ΔG) for this reaction in mammalian mitochondria at 25°C is ∼0 kJ>mol (Table 13.2).(a) Calculate the ratio of [isocitrate]>[citrate] in mitochondria.(b) Is this reaction likely to be a control point for the citric acid cycle? Whyor why not?Given the following information, calculate the physiological ΔG of the isocitrate dehydrogenase reaction at 25°C and pH 7.0: [NAD+]/[NADH] = 8, [α-ketoglutarate] = 0.1 mM, and [isocitrate] = 0.02 mM. Assume standard conditions for CO2 (ΔG°′ is given in Table). Is this reaction a likely site for metabolic control?
- Consider the typical beta oxidation of linoleic acid (C18:2 ^Δ9, 12): How many ATP are generated in complete oxidation of linoleic acid? How many NADH are generated in complete oxidation of linoleic acid? How many FADH2 are generated in complete oxidation of linoleic acid?Write a balanced chemical equation for the pentose phosphate pathway in the first two modes depicted as shown, where (a) ribose-5-phosphate synthesis is maximized and (b) NADPH production is maximized, by conversion of the sugar phosphate products to glucose-6-phosphate for repeated operations of the pathway.Phosphofructokinase-1 is the main flux controlling enzyme for glycolysis. It is inhibited by high [ATP]. There exist metabolic circumstances in which the inhibition by ATP is overridden. Draw velocity vs. [S] graphs showing the inhibition of PFK-1 activity by ATP and the circumstance in which the inhibition by ATP is overridden.
- Decylic acid is a saturated fatty acid that occurs naturally in coconut oil and palm kernel oil. Calculate the net ATP yield when decylic acid undergoes complete B oxidation. The formula of decylic acid is shown below: (Given: The oxidation of one NADH yields 2.5 ATP; the oxidation of one FADH2 yields 1.5 ATP; and the oxidation of one acetyl CoA yields 10 ATP.) O 50 ATP O 52 ATP 66 ATP OH O 64 ATP.Intramitochondrial ATP concentrations are about 5 mM, and phosphate con- centration is about 10 mM. If ADP is five times more abundant than AMP, calculate the molar concentrations of ADP and AMP at an energy charge of 0.85. Calculate AG for ATP hydrolysis at 37 °C under these conditions. The energy charge is the concentration of ATP plus half the concentration of ADP divided by the total adenine nucleotide concentration: [ATP] + 1/2[ADP] [ATP] + [ADP] + [AMP]The standard reduction potential for ubiquione (A or coenzyme Q) is .045 V, and the standard reduciton potential (E) for FAD is -0.219 V. Using these values, show that the oxidation for FADH2 by ubiquinone theoretically liberates enough energy to drive the synthesis of ATP. Faraday constant =96.48KJ/Vol delta G' standard for ATP Synthesis is +30.5 KJ/mol R=8.314 J/mol K=1.987 cal/mol K