Below are parts of the mitochondrial DNA codes for the American black bear, thegiant panda, the red panda, and the raccoon.MITOCHONDRIAL DNA CODESOrganismDNA CodesAmerican black bearATT GGA GCA GAC TTAGiant pandaATT GGC ACTAAT CTARed pandaATT GGA ACT AAC CTTRaccoonATC GGA TCTAAC CTBased on this information, which two species are most closely related?O the American black bear and the giant pandaO the red panda and the racceonKoryO the American black bear and the raccoonO the red panda and the giant pandaourcesynergy• PreviousNext

Name: Below are parts of the mitochondrial DNA codes for the American black
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Below are parts of the mitochondrial DNA codes for the American black bear, thegiant panda, the red panda, and the raccoon.MITOCHONDRIAL DNA CODESOrganismDNA CodesAmerican black bearATT GGA GCA GAC TTAGiant pandaATT GGC ACTAAT CTARed pandaATT GGA AC

A double helix model of a DNA molecule in which the strands of DNA joined by hydrogen bonds and are…

Science

Biology

Below are parts of the mitochondrial DNA codes for the American black bear, the giant panda, the red panda, and the raccoon. MITOCHONDRIAL DNA CODES Organism DNA Codes American black bear ATT GGA GCA GAÇ TTA Giant panda ATT GGC ACT AAT CTA Red panda ATT GGA ACT AAC CIT Raccoon ATC GGA ICT AAC CIT Based on this information, which two species are most closely related? O the American black bear and the giant panda O the red panda and the racceon the American black bear and the raccoon the red panda and the giant panda

Below are parts of the mitochondrial DNA codes for the American black bear, the giant panda, the red panda, and the raccoon. MITOCHONDRIAL DNA CODES Organism DNA Codes American black bear ATT GGA GCA GAÇ TTA Giant panda ATT GGC ACT AAT CTA Red panda ATT GGA ACT AAC CIT Raccoon ATC GGA ICT AAC CIT Based on this information, which two species are most closely related? O the American black bear and the giant panda O the red panda and the racceon the American black bear and the raccoon the red panda and the giant panda

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter11: Evidence Of Evolution

Section: Chapter Questions

Problem 3FIO

See similar textbooks

Related questions

Q: present in the mitochondrial genome.

A: Mitochondria is called the powerhouse of the cell. It is a unique organelle along with chloroplast…

Q: Hemoglobin, a protein found in red blood cells, carries oxygen. Abnormal hemoglobin cannot carry as…

A: Part A:Messenger RNA sequences produced from the normal and abnormal DNA sequences:Normal DNA…

Q: Two diploid species of closely related frogs, which we will callspecies A and species B, were…

A: Evolution is defined as inheritable changes over multiple generations of a population of organisms.…

Q: House cats normally have 18 toes. However, they can have up to 27 toes. The condition of having more…

A: Genetic drift is a mechanism of evolution that causes changes in the frequencies of alleles in a…

Q: Following a gene duplication, two genes will accumulate different mutations, causing them to have…

A: Duplication occurs when a broken end of a chromosome is added from its homologous chromosomal…

Q: View the Diagram given below. Then read the questions given on the right-hand side. Answer each…

A: Cladogram is a evolutionary tree representing relationship with ancestors. It is based on…

Q: Consider the following four DNA sequences taken from the a homologous gene from four different…

A: Multiple sequence alignment is majorly used to find out evolutionary relationship between…

Q: The gene known to be mutated in cases of Agammaglobulinemia 2 (which is inherited in an autosomal…

A: The IGLL1 gene is known to be mutated in cases of Agammaglobulinemia 2, which is an inherited…

Q: DNA fingerprinting involves using restriction enzymes to cut DNA at a specific sequence, resulting…

A: DNA fingerprinting: DNA fingerprinting is a technique that involves the isolation of genetic…

Q: An isolated population of prairie dogs has longer than average teeth. As a result, they can eat more…

A: Introduction A mutation is a change in a DNA sequence. Mutations can result from DNA copying…

Q: The SCAM data for positions V51C and Y96C are different to the other datasets. Describe how the data…

A: Western blot :It is a method for locating and identifying particular proteins in a sample of tissue…

Q: (B) Australian Bonobos Pima (No. American) Papua New Guinea highland Georgian Uzbek (central Asian)…

A: Phylogenetic tree or the cladogram is constructed on the basis of the similarity among the organism…

Q: Saola Pseudoryx nghetinhensis (Species) Discuss how you will manage new founders of the saola…

A: Pseudoryx nghetinhensis, commonly known as the saola, is a critically endangered species of bovine…

Q: You isolate bacteria from several different pools at the recreation center. Curious about which…

A: BLAST are the tools that are used to identify the differences and similarities between the protein…

Q: dichotomous key? Why does the term “dichotomous” let you know that? (hint: look up the Greek roots…

A: In phylogenetics, a single-access key (also called dichotomous key, sequential key, analytical key,…

Q: The human PAH gene encodes the enzyme phenylalanine hydroxylase. Deficiency of this enzyme activity…

A: Genetic disease is caused due to mutation in the gene that may result in malfunction of the gene…

Q: a decision was made that the next step is nucleotide position 10. Why not choose position 3? In your…

A: The objective of the question is to understand why nucleotide position 10 was chosen over position 3…

Q: DNA fingerprinting involves using restriction enzymes to cut DNA at a specific sequence, resulting…

A: DNA fingerprinting is a technique to distinguish between individuals of the same species using…

Q: Explain why genes A2 and B2 in Figure 20.9 are orthologs and not paralogs.

A: Genes are the set of nucleotides present in a chromosome that encodes for particular information…

Q: The following data for the genotypes at the alcohol dehydrogenase locus were observed from a sample…

A: The Hardy-Weinberg law states that when a population is in equilibrium, the genotypic frequencies in…

Q: out of t If one of the parents is found to have the mutation that causes DAD, it is most likely the…

A: Diabetes mellitus and deafness (DAD) is a genetic disorder caused by a specific point mutation at…

Q: You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1:…

A: The human genome is a complete set of nucleic acid sequences for humans, encoded as DNA in the 23…

Q: Why do scientists believe that the sickle-cell trait has not evolved out of the human population yet…

A: Sickle cell anemia is one of the important genetic disorder occurs in most of the world population.…

Q: homology modelling and such are available free online. State the functions of CLUSTAL W, BLAST and…

A: Numerous computational methods are used in bioinformatics, that include sequence and structural…

Q: Black body Black body wild wild Black body Black body wild Brown eyes wild Brown eyes wild Brown…

A: Linkage map or chromosomal map is the linear graphical representation of the sequence and relative…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

Below are parts of the mitochondrial DNA codes for the American black bear, the
giant panda, the red panda, and the raccoon.
MITOCHONDRIAL DNA CODES
Organism
DNA Codes
American black bear
ATT GGA GCA GAC TTA
Giant panda
ATT GGC ACT
AAT CTA
Red panda
ATT GGA ACT AAC CTT
Raccoon
ATC GGA TCT
AAC CT
Based on this information, which two species are most closely related?
O the American black bear and the giant panda
O the red panda and the racceon
Kory
O the American black bear and the raccoon
O the red panda and the giant panda
ources
ynergy
• Previous
Next

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1- Introduction

VIEW

Step 2- Explanation

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DNA sequences CGCCTAGTCA Strain 1 TCCCTACT CG Strain 2 ATCCTATAAC Strain 3. GACCTAAGCT Strain 4 Strain 2 = Strain 3 = 40 Strain 4 = 50 60 70 d Please use the above figure for the following question. If no figure appears, please use Figure 4. Fill in the blanks by writing the letter of the location where each of the strains belongs in the cladogram. Strain 1 = Percent Relatedness b
In the table below, the letters represent amino acids that make up a polypeptide found in all the vertebrates listed. Construct a cladogram from the different amino acid sequences given. Assume that the sequences are already aligned and begin with comparing the number of differences between species.
From the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 O 7 2 3 4 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT E Species Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 5 6 7
By using those sequences to explain the tiling path for each sequence
DNA sequences were analyzed from humans and three other mammals: species X, Y, and Z. Which of these mammals is most closely related to humans? (Note: Regions identical to human DNA are shown in bold type.)
A student in lab has just used their mtDNA chromatogram to construct a list of mutations found in their sequence. Based on the key mutations found in their sequence, they believe they belong to either haplogroup Q or haplogroup M1. The presence of which mutation would help them determine between haplogroup Q or haplogroup M1? T16278C G16129A! T16187C T16311C! T16362C A16241G
The phylogenetic tree of the OCTN homologs below was generated with the following accession numbers as basis: NP_957143.1 - OCTN of unknown function CDM63451.1 - OCTN specific for ergothioneine transport XP_021324939.1 - OCTN specific for carnitine transport Design the phylogenetic tree to make it look more interesting by highlighting the distinct clades or putting a visual emphasis on the gene you are trying to analyze. Provide a caption for this figure.
The phylogenetic tree of the OCTN homologs below was generated with the following accession numbers as basis: NP_957143.1 - OCTN of unknown function CDM63451.1 - OCTN specific for ergothioneine transport XP_021324939.1 - OCTN specific for carnitine transport Design the phylogenetic tree to make it look more interesting by highlighting the distinct clades or putting a visual emphasis on the gene you are trying to analyze. Provide a caption for this figure. asap please.
What organism produced this gene sequence? Provide the full genus and species name. Make sure to spell it correctly! (Hint: Use "standard database" and not the "TRNA database" in your search.) >Sequence2c GCGGTTCCACAAGACCCTGAGGCGCCTGGTGCCTGACTCGGACGTCCGGTTCCTCCTCTC
The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.
A team of scientists has determined the gene sequence of a newly discovered species of insect to be: 5'- ATG GGT GAT GTT GAA AAA-3'. The table shows the gene sequences of four other species of insects. Gene Sequence Species newly discovered species 1 2 5'-ATG GGT GAT GTT GAA AAA-3' 5'-ATC GGT GAT GTT GAA ATA-3' 5'-ATG GGT GAA GTT GTT AAA-3' 5'-ATG GGT GAA GTT GAA AAA-3' 5'-ATG GGC GAT GTT GAA TTT-3' 3 4 Using the biochemical similarities, what can be generalized about the evolutionary relatedness of the newly discovered species? The newly discovered species is most closely related to species 3. The newly discovered species is equally related to all four species of insects. The newly discovered species is most closely related to species 4. The newly discovered species is not related to any of the four species of insects.
Compare the amino acid sequence of cytochrome-c protein in humans to rhesus monkey, kangaroo, snapping turtle, bullfrog and tuna by counting the number of differences of amino acids in the same regions. Write your answer on the table below.