Based on the attached picture Are the blue eye color and white body color mutations located on the X-chromosome and/or on an autosomal chromosome? Explain your answers and show your work.

Q: Cross C: Homozygote wild type flies (+/+) were crossed with white eye flies. for the F1 and F2…

A:

Q: Campomelic dysplasia (CMD1) is a congenital humansyndrome featuring malformation of bone and…

A: Campomelic dysplasia is a rare genetic disorder characterized by bowing of the long bones and many…

Q: Mutations in the HPRT1 gene in humans result in atleast two clinical syndromes. Consult OMIM…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: 8. Which is the correct description of the human chromosome number? * O2n =23 (where n=23, the…

A: Chromosomes are long, thread-like structures made of DNA and protein molecules that carry genetic…

Q: In a sample of 1000 patients with Down syndrome, a geneticist discovers that 95% of them are…

A: Trisomy is a kind of polysomy in which three instances of a particular chromosome occurs. Generally…

Q: This is a two part question: Please complete part a and part b, failure to complete both, you will…

A: The diagram below shows meiosis which is the kind of reduction division in which the chromosome…

Q: Standard 2b A male individual who is XYSRY has the following genotype for the AMH gene on chromosome…

A: Humans have 23 pairs of chromosomes of which 22 pairs are autosomal and the 23rd pair is…

Q: The Klinefelter syndrome (disomy of the X chromosome in males) is a genetic disease caused by…

A: The normal humans contain 46 chromosomes. Between these 46 chromosomes, 44 are autosomes and 2 are…

Q: The following diagram represents two nonhomologous chromosomes: A B • C D E F G R S • T U V W X What…

A: There are four types of chromosomal mutations: deletion, duplication, inversion and translocation.…

Q: Diploid Number of chromosomes, Sex Chromosomes, (+/- whole) Chromosome (+/- partial) e.g. 47, XY,…

A: Turner syndrome, a condition that mostly affects the females, which is caused when one of the X…

Q: If the mutation occurred in Jonathan's somatic cells when he was in his 30's, what type of alleles…

A: A neurodegenerative condition that is primarily inherited is Huntington's disease (HD), also known…

Q: ile she does not have the condition she has a other who has the condition. Hemophilia is due a…

A: Hemophilia being an x linked recessive disease is a disease in which X chromosome is mutated. As…

Q: A phenotypically normal individual has the following combinations of normal and abnormal…

A: Chromosomal deletion is simply deletion of the part of the chromosome. Chromosomal inversion is a…

Q: Create a box-and-arrow model that describes: a. how information in the AMH gene results in the…

A: Humans have 23 pairs of chromosomes of which 22 pairs are autosomal and the 23rd pair is sex-linked.…

Q: The genotype of a dwarf mouse is Igf2 Igf2–. What is the genotype of its father who has normal body…

A: Knowing how features are passed down from parents to children requires incorporating knowledge of…

Q: Draw a chromosome and a pair of homologs (or homolog pairs, or homologous chromosomes). Label on the…

A: Chromosomes are made up of proteins and DNA molecules. At the time of cell division they divides so…

Q: Figure 1. Showing a homologous pair of chromosomes that carry two linked genes. Here we can see that…

A: Alleles are two forms of the gene. If two genes are linked, their independent assortment during…

Q: How many Barr bodies in a person with genotype XXXXX? How is the structure of a Barr body different…

A: The mammalian males contain XY chromosome and females contain XX chromosome. So, the number of…

Q: Colorblindness and hemophilia are both X-linked traits in humans. Explain how a female who has a…

A: Colourblindness and haemophilia are both X-linked traits in humans. Haemophilia is a bleeding…

Q: Karyotype Analysis: Does this person have any chromosomal abnormalities? Is the karyotype normal?…

A: A karyotype is an actual photograph of the chromosomes from one cell. The cells analyzed are usually…

Q: A woman with no phenotype is known to have a 14:21 translocation. 1. With respect to only…

A: The rearrangement of chromosomes in which one portion of the chromosome is breakdown and is attached…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: Mitotic nondisjunction can occur, particularly in tumor cells. Assume a single nondisjunction event…

A: The failure to separate homologous chromosomes or chromatids during cell division (mitosis or…

Q: 1 In humans, red-green colorblindness is a sex-linked recessive condition. Show a cross between a…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: Diploid Number of chromosomes, Sex Chromosomes, (+/- whole) Chromosome (+/- partial) e.g. 47, XY,…

A: Klinefelter’s syndrome and one Barr body Klinefelter’s syndrome is due to the trisomy of sex…

Q: Select the true statements. (can be multiple).     Sperm and egg cells are diploid, meaning that…

A: Haploid cells contain a single set of chromosomes. Diploid cells contain two sets of chromosomes.

Q: Barr Bodies, Sex Chromosomes and Diploid Number Number of Barr Bodies Phenotypic Sex of Individual…

A: BARR BODY It is an inactivated, condensed X chromosome found in female cells. Barr bodies are…

Q: Using the pedigree below for an autosomal dominant disorder to determine the phase (which ones are…

A: Pedigree analysis is a valuable tool for understanding the inheritance patterns of genetic…

Q: Prader-Willi Syndrome (PWS) is caused by a mutation in an autosomal gene that is maternally…

A: Given information Prader-Willi Syndrome occurs by the mutated autosomal gene that is maternally…

Q: Here are the results of the testcross: Green-eyes, wild-type wings 245 Green-eyes, miniature wings…

A: 6) The number of flies with green eyes and and miniature wings are 232, these organisms are least in…

Q: Discuss the types of experimental observations that Mary Lyonbrought together in proposing her…

A: A sex chromosome also termed as allosomes are involved in the determination of sex in individuals.…

Q: tructural errors can occur during Meiosis which can lead to h disorders. Examine the figure below…

A: Chromosome structural errors : These are changes to the structure or number of chromosomes  It can…

Q: Draw a Punnett square for the dihybrid cross described below (it is the same story as given for…

A: X linked characters are those where the the gene in question is located on the X chromosome. Females…

Q: The gene causing Coffin-Lowry syndrome (OMIM 303600) was recently identified and mapped on the human…

A: Males and females of a species have separate sex chromosomes. The number of copies of seX-linked…

Q: Briefly explain how McClintock determined that D s was occasionallymoving from one chromosomal…

A: Transposable elements, also known as jumping genes are short segments of DNA, which have special…

Q: The following normal human sister chromosomes DO NOT necessarily have in common with each other:…

A: BASIC INFORMATION CELL It is considered as the basic unit of life Every organism is made up of cell…

Q: can someone help me fill out these charts? I’m having trouble grasping this concept on chromosome…

A: Humans are multicellular organisms. The cells of our bodies divide continuously for the normal…

Q: In Drosophila, an X-linked recessive mutation, (s) causes irregular wing margins. Give the…

A: Drosophila melanogaster is a fruit fly having 2n = 8 chromosomes. The male has a sex pair of…

Q: Assume that the Holliday junctions resolve so that there is no crossing over (that is, there is no…

A: For the maternal chromosome and paternal chromosome see below.

Q: What is dosage compensation with respect to the sex chromosomes? Briefly explain how this is…

A: The method by which organisms adjust gene expression between individuals of different biological…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.