Balance the following equation occurring in a basic aqueous solution. Indicate which method you have chosen and show all steps relating to the balancing method. Once completed, show one method to check your work. MnO4 (aq) MNO2(ag) + CO2(g)

Balance the following equation occurring in a basic aqueous solution. Indicate which method you have chosen and show all steps relating to the balancing method. Once completed, show one method to check your work. MnO4 (aq) MNO2(ag) + CO2(g)

Chemistry

10th Edition

ISBN:9781305957404

Author:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Publisher:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Chapter1: Chemical Foundations

Section: Chapter Questions

Problem 1RQ: Define and explain the differences between the following terms. a. law and theory b. theory and...

See similar textbooks

Related questions

Q: What does sterically hindered means? How do i identify it given a chemical figure? Please show…

Q: H2S + LIOH → LizS + H2O

A: The given Chemical Equation can be balanced as follows -

Q: QUESTION 55 The likelihood that the longer elution times (Rf) were due to the following: O The more…

A: As per our guidelines, I can answer only first question. Because you have posted multiple questions.…

Q: help please answer in text form with proper workings and explanation for each and every part and…

A: Part 2: Explanation:Step 1: Understand the experiment.The experiment measured the activity of…

Q: What amino acid substitution would be accompanied by the largest decrease in enteric water penalty?…

A: Amino acid along with ionizing sie chain ,such as asp, glu, His, liz, impart important properties to…

Q: Disaccharides are described by the position of the anomeric carbon and the numbering of the atoms…

Q: The use of salt bridges or hydrophobic interactions (or pockets) to stabilize interactions between…

A: The quaternary structure of a protein is the association of several protein chains or sub-units into…

Q: In polarimetry when lactic acid measured was contaminated with glycerol, what happens to the…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Which of the structures below corresponds to the dipeptide cysteylananine? The parentamino acids are…

A: Amino acids contain carboxylic acid and an amine functional group on the same carbon atom. Amino…

Q: The predominant noncovalent interaction involving the polypeptide backbones of a- helices and…

A: Proteins, the molecular workhorses of living organisms, owe their functionality to their intricate…

Q: Using alanine as an example, draw possible conformations of alanine in a peptide chain (Ala-Met-Thr)…

Q: Proteins are made from chains of amino acids. The amino acids are joined together by structures…

A: The structure of the dipeptide that is formed from two glycine molecules at the pH of most body…

Q: How many stigma bonds are in CH3CH2CH2SH?

A: Given, The structural formula = CH3CH2CH2SH The compound name of the structural formula CH3CH2CH2SH…

Q: Using proper convention, provide the amino acid sequence for the following protein. 19 BE BEL 301 ||…

A: Using the proper convention, provide the amino acid sequence of given protein:

Q: 1-proteins-lab-manual?module_item_id=44333 A= abc Where "A" is absorbance, "a" is molar…

A: First question had been answered. Absorbance of a solution can be calculated using Beer Lambert law.

Q: A polypeptide is ... O None of the above. O an addition polymer of amino acids O a part of nucleic…

Q: 46. The phosphodiester linkages in DNA and in RNA are, respectively: a. 2' to 3', 3' to 2' b. 2' to…

A: DNA and RNA are nucleic acids. In both phosphodiester linkage is present .

Q: Identify an amino acid that complies with the following characteristic: (Write the COMPLETE name)…

A: Amino acids are molecules that combine together to form proteins. These are a group of molecules…

Q: draw the dipeptides of Thr-Ala and circle the peptide linkage

A: We have to draw the dipeptides of Thr-Ala and circle the peptide linkage

Q: Classify the following characteristics as a type of 3D protein structure. Primary, Secondary…

A: From given structures It is matched with each of the specific component and function accordingly as…

Q: Classify the following as a lipid, carbohydrate, or amino acid: (EOCQ 58) CH,OC(CH,)1,CH, а.…

A: We are authorized to answer three subparts at a time, since you have not mentioned which part you…

Q: How many fused rings are there in steriod?

Q: a. which amino acid can form an N-linked bond with any carbohydrate b. which amino acid would most…

A: Proteins are made up of amino acids. The amino acids are consist of one carboxylic acid group, one…

Q: Refer to the given figure below. Peptide and protein synthesis in the body occurs at the ribosome.…

A: Elimination reactions are those in which a substance is eliminated during the course of the…

Q: new synthetic fibres in the last 15 years in the fibre industry? their chemistry their usuage

A: Synthetic fibres are fibres that are man-made through chemical processes. Some of its examples are…

Q: 6. You are designing a protein, which needs to be stable at high temperatures. Which amino acids…

A: Amino acids are the monomeric units that are used in the synthesis of protein molecules. There are…

Q: If an association between an exposure and an association is differs significantly in strata of a…

A: 1. Answer - Given statement is true . Explanation - The effect or association between an exposure…

Q: The below molecule of mannose is the [Select ] anomer. A glucose molecules used to my cellulose…

A: Beta glucose( group on 1 ,6 position are on same side) see in below attached figure. is the monomer…

Q: Fill in the side chains (including stereochemistry) on the dipeptide backbone below to make the…

A: All the amino acids exhibit L-stereochemistry except glycine.

Q: 2N N H H NH NH O

A: Given is organic compound.The name of given compound is Macimorelin.

Q: Use the following pentapeptide (5 amino acids linked together) structure and draw it again with the…

Q: НОНН С. H,N-C-C-N-C-C-OH НОСН CH;CHCH, HOH H O TITT I H,N-C-C-N-C-C-OH d. H.NCH.CH.CH.СHН H

A: Amino acids are building blocks of proteins. they're concerned with many chemical and biological…

Q: Can you please draw me two versions of the dipeptide tyr-phe that represent the two resonance forms…

Q: Draw the structure of the dipeptide Lys-Pro that is predominant at pH 8. Include all of the atoms…

A: To draw the structure of a dipeptide Lys-Pro that is predominate at pH equals to 8.

Q: Glycogen is a branched-chain polymer of α-D-glucose units in which the chain is formed by C1—C4…

A: Polysaccharides contains large number of monosaccharide units joined together through glycosidic…

Q: Intermolecular chain transfer R R- MLn MLn P. R Intramolecular chain transfer Ring-Opening…

Q: In addition to their use in water treatment, ion-exchange resins are used to extract Au, Ag, and Pt…

A: Small repetitive units of a compound called monomers are connected chemically to form a long chain…

Question

100%

Pls help ASAP.

32. Balance the following equation occurring in a basic aqueous solution. Indicate which method you have
chosen and show all steps relating to the balancing method. Once completed, show one method to
check your work.
MnO, (ac) + C2O,²(aq) → MNO2(aq)
+ CO2(g)
4.
(ад)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

I want solution asap
A circular double-stranded DNA molecule contains 4200 base pairs. In solu- tion the molecule is in a B-form helix, with about 10.5 base pairs per turn. The DNA circle has 12 superhelical turns. What is its superhelix density o?
Туре: 17) CAH8+O2→ - Туре: 18) KCI + Mg(OH)2 → Туре: 19) Zn +_ Au(NO2)2→ Туре: 20) KOH +_ H2SO4 → - Туре: 21) Bas + PtCl2> - Туре: DELL
Which statement best explains the chemical differencesbetween DNA and RNA? (a) DNA has two different sugarsin its sugar–phosphate backbone, but RNA only has one.(b) Thymine is one of the DNA bases, whereas RNA’s correspondingbase is thymine minus a methyl group. (c) TheRNA sugar–phosphate backbone contains fewer oxygenatoms than DNA’s backbone. (d) DNA forms double helicesbut RNA cannot.
Provide the structure of atactic polystyrene. O Interactive 3D display mode Interactive 3D display mode Interactive 3D display mode
need help with D)Lipid
Cheto
Truel False: you are asked to determine if the statement is TRUE or FALSE. You must write out the w provide the reason WHY the statement is false in the space below the statement. Do not just change Macromolecules within the cytosol interact in the quarternary structures via covalent bonds. I U S X2 x2 B. !!
Identifying and drawing peptide bonds V Draw the structure of serylarginine, a dipeptide made from serine and arginine, as it would appear at physiological pH. Explanation @ Click and drag to start drawing a structure. Check # $ * % MacBook Pro 80 & 0 X A :0 3 C © 2023 McGraw Hill LLC. All Rights Reser
Please help me with the following 1) sketch a phosphodiester bond 2) Make the two amino from the image below. And contrast the polarity of the side chains
Can u please solve these twl
Modify isoleucine to show its structure at pH 1 and pH 13. Modify each amino acid by adding or removing atoms or bonds and by adding charges where appropriate. pH 1 pH 13 Select Draw Rings More Erase Rings More Erase C с CH₂ CH₂ H₂C H₂N 1 CH₂ | CH | 310 H― H O H N U с || 0 H Q2 Q Select Draw / ||| ||| H₂C H₂N 1 CH₂ | CH - n O H | H 0 H N H Q2Q