ATTTGAGCC- Original ATTGAGCC - Mutated   The example above is an example of a  Nonsense Deletion- Substitution Insertion- Frameshift Deletion -Frameshift

Q: Which of the following steps is NOT used in whole genome sequencing? Select one alternative: O…

A: WGS stands for whole-genome sequencing and is a method for examining complete genomes. Identifying…

Q: RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA, This strand…

A: Transcription is the process of transforming the information of DNA sequences in to the mRNA strand.

Q: Please answer fast True or False During transcription in prokaryotes, the initiation of…

A: Transcription is a process in which the double stranded DNA is converted to RNA which is translated…

Q: please answer remainnig questions too thanks. 1) Missense mutation 1)Deletion in Exon2, causing…

A: Mutations arise when a DNA gene is damaged or altered in such a manner that the genetic message…

Q: From the list given - choose all the regulatory sequences that you thỉnk would control the…

A: Introduction Gene expression in eukaryotic cells is regulated by repressors as well as by…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: Sort the items below into the gene therapy vector categories provided AAV vector lentiviral vector…

A: Q 14: answer :-  Gene therapy is a promising field that holds the potential to treat a wide range of…

Q: Matching type: Choose the effect of the given agents to translation or transcription  Choices: RNA…

A: Transcription and translation are the processes by which a gene can express itself in the form of…

Q: True or False: 1. All functional transcripts have been initiated, elongated and terminated with…

A: False : post transcription events include splicing, capping, tailing. Initiation is the beginning of…

Q: Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point…

A: When a point mutation occurs, one of three things may happen:Due to the mutation occurring in a…

Q: searcher has made a UAS transgenic line that drives a muscle transcription factor is attached to GFP…

A: Recessive character is only expressed in homozygous condition where as dominant character is…

Q: A. The insertion shifts the reading frame to the right .The deletion frameshifts the reading frame…

A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Q: "The design of trans-Tango is modular, so it is not limited to tracing experiments. Since the…

A: It is certainly possible to further advance the trans-Tango system to label third-order neurons,…

Q: What would be the consequence of inserting 10 random base pairs immediately downstream of the -10…

A: The insertion of 10 random base pairs immediately downstream of the -10 box in a strong promoter may…

Q: The following sequence is a mutant version of the above gene that is present in a mutant bacterial…

A: As required, only E and F has been answered.

Q: After comparing the whole genome sequencing results from a candidate that you suspect has a mutation…

A: A missense mutation is a type of genetic mutation that results in the substitution of one nucleotide…

Q: DNA encodes the cell's genetic instructions for making proteins. The process of making proteins from…

A: Proteins are essential macromolecules that perform various functions within cells and organisms. The…

Q: Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and…

A: Codons It refers to the sequence of three consecutive nucleotides that are present in the DNA or RNA…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: You ligate a CDNA fragment with Bgl Il and Xho I sticky ends into the Bgl Il and Xho l sites of the…

A: Given that  *Ligated a CDNA fragment with Bgl II and Xho I into Bgl II and Xho I sites  respectively…

Q: Mutations can be classified as small-scale or large-scale, depending on the number of nucleotides…

A: a) change from CCGATG to CCGGATGThe sequence is altered from CCGATG to CCGGATG by the insertion of…

Q: 32 The repressor is constitutively synthesized [all the time] in both the lac and trp operons.…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Correct! The Leu codon is changed to a nonsense codon by a single-base substitution How many…

A: The process by which mRNA is produced from DNA is called transcription and the process by which…

Q: After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter…

A: Introduction Peptides are short chains of amino acids with peptide bonds connecting them.…

Q: Discuss possible reasons why the different RNAi phenotypes may differ in penetrance from each other

A: RNA interference (RNAi) It is a process in which RNA molecules are involved in sequence-specific…

Q: The enzyme guanylyl transferase is usually associated with which of the following? phosphorylated…

A: Introduction :- Guanylyl transferase is an enzyme that adds a guanine nucleotide to the 5' end of a…

Q: What is the actual biological purpose of the CRISPR/Cas9 system?

A: All biological information of an organism is stored inside the biomolecule called DNA.  Gene are the…

Q: Eukaryotic chromosomes are linear DNA molecules, yet the DNA of a chromosome retains a high level of…

A: DNA is a long polymer that is many times larger than the cell it is found in. The reason it is able…

Q: explanation

A: To restore a protein's normal function after a frameshift mutation, the reading frame must be…

Q: Which of the following locations would NOT be a possible site for an enhancer for a gene in a…

A: A gene is a unit of heredity that is responsible for the transmission of a specific trait or…

Q: 5. Describe the method of random mutagenesis using degenerate oligonucleotide primers 6. What are…

A: We are authorized to answer one question at a time since you have not mentioned which question you…

Q: s the PAM sequence required for Cas9-mediated cleavage of a single-stranded strand of DNA (when that…

A: The protospacer adjacent motif is a short DNA sequence that follows the DNA region targeted for…

Q: Match the eukaryotic rRNA molecules with the proper ribosomal subunit. 55 FRNA [Choose ] 5.8S rRNA…

A:

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase…

A: The image shows 10 statements. We have to determine whether the statement is True or False. The…

Q: A bacterial cell undergoes a change and the two Trp codons of the tryptophan leader sequence are…

A: Tryptophan operon is an example of repressible operon which remain transcriptionally active and…

Q: In which direction along the template must theRNA polymerase in Figure Q6–1 be moving to have…

A: Throughout transcription, the RNA polymerase proceeds along the template strand in a 5'-3'…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: DNA is two stranded helical structure which act as template for making of mRNA. It also functions as…

Q: From the list given - choose all the regulatory sequences that you think would control the…

A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…

Q: Enzyme(s) used PstI ECORI HincII Band sizes observed (kb) 5.3, 2.7 5.4, 2.6 Smal Xbal ВатHI 4.5, 3.5…

A: Restriction enzymes cut the DNA at a specific sites and into small fragments. This fragments can be…

Q: Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: Which of the following lists the three steps of translation in their proper sequence? O 1.…

A: Translation is defined as the process of protein synthesis. It takes place in the cytoplasm.

Q: Which of the following DNA mutations is almost certain to result in a shorter than normal protein?

A: In the present circumstance, we possess a DNA sequence and its equivalent mRNA sequence. It is…

Q: Parts A-C in the table show the genotypes for two partial diploid strains of the lac operon. Gene…

A: Operon is the bacterial gene regulatory mechanism in which the expression (transcription) of…

Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical…

A: ANSWER;-  Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content =…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.