Don't use vector array .using ifstream and ofstream. C++ program The only input to your program is the names of the input txt fileand output txt file name. The input text file will have exactly10 lines. Each line will have:1- One of 5 words: Array, Front, Sorted, Positive, or Negative.This indicates the type of array to create.2- An integer which indicates the number of elements in thearray.3- The elements to be entered into the array.The following is an example content of the file:Sorted 108.4-42.311807779512100Array 7Front 53.494.7398.47.90.441Array 6Sorted 445238.53.9842.5904111Sorted 8741.13.288Array 6Front 313.57.69.33171.5Positive 77.9-1-449.74.3-1Negative 888-1.5-40-9.74.313-11You should use polymorphism in your code by creating an arrayof FloatArray* in main.Read from the txt file and allocate your objects according to thetype of array and fill the arrays using the extraction operator>>.After finishing reading the file, you should write your arrays toanother text file using the insertion operator<<.The output file for the above text file will be:10|7|5|6|4|8|6|3|3|4|-42.378.411127780951003.429.4.7310.447.94845238.53.9842.54901111.133.24798813.57.63311.5574.37.99.7-40-11-9.7-1.5Where each line begins with the number of elements followedby the character T', a tab, then the array elements separatedby tabs.Don't forgot to deallocate by deleting your objects in main afterfinishing.A sample run is found below:Enter the name of the input file:in.txtEnter the name of the output file:MyOut.txtProcess returned 0 (0xe)Press any key to continue.execution time : 16.048 s TaskDeclare and implement 5 classes: FloatArray, SortedArray,FrontArray, PositiveArray & NegativeArray.1- The FloatArray class stores a dynamic array of floats and itssize. It has:A parameterized constructor that takes the array size.- An add method that adds a float at the end of the array.- Overloading for the insertion operator << to write the array to afile (ofstream)- Overloading for the extraction operator >> to read the arrayelements from the file (ifstream) and add them to the array.- A destructor to deallocate the array2- The SortedArray inherits from FloatArray. It has:- A parameterized constructor that takes the array size.- An add method that adds a float at the right place in the arraysuch that the array remains sorted with every add. Don't add tothe array then sort but rather add in the right place.3- The FrontArray inherits from FloatArray. It has:A parameterized constructor that takes the array size.An add method that adds a float at the front of the array.4- The PositiveArray that inherits from SortedArray. It has:A parameterized constructor that takes the array size.- An add method that adds a float to the array only if it's apositive number. It then uses the add method of SortedArray.5- The NegativeArray that inherits from SortedArray. It has:- A parameterized constructor that takes the array size.- An add method that adds a float to the array only if it's anegative number. It then uses the add method of SortedArray.The only input to your program is the names of the input txt fileand output txt file name. The input text file will have exactly10 lines. Each line will have:1- One of 5 words: Array, Front, Sorted, Positive, or Negative.

Actually, array is a collection of elements.

and output txt file name. The input text file will have exactly 10 lines. Each line will have: 1- One of 5 words: Array, Front, Sorted, Positive, or Negative. This indicates the type of array to create. 2- An integer which indicates the number of elements in the array. 3- The elements to be entered into the array. The following is an example content of the file: Sorted 10 8.4 -4 2.3 11 80 7 77 95 12 100 Array 7 Front 5 3.4 9. 4.7 3 9. 8. 4 7.9 0.44 1 Array 6 Sorted 4 45 23 8.5 3.98 4 2.5 90 6. 4 111 Sorted 8 7 3 4 1.1 3.2 88 Array 6 Front 3 13.5 7.6 9 33 1 7 5 1.5 Positive 7 7.9 -1 -44 9.7 4.3 -1 Negative 8 88 -1.5 -40 -9.7 4.3 13 -11 You should use polymorphism in your code by creating an array of FloatArray* in main.

and output txt file name. The input text file will have exactly 10 lines. Each line will have: 1- One of 5 words: Array, Front, Sorted, Positive, or Negative. This indicates the type of array to create. 2- An integer which indicates the number of elements in the array. 3- The elements to be entered into the array. The following is an example content of the file: Sorted 10 8.4 -4 2.3 11 80 7 77 95 12 100 Array 7 Front 5 3.4 9. 4.7 3 9. 8. 4 7.9 0.44 1 Array 6 Sorted 4 45 23 8.5 3.98 4 2.5 90 6. 4 111 Sorted 8 7 3 4 1.1 3.2 88 Array 6 Front 3 13.5 7.6 9 33 1 7 5 1.5 Positive 7 7.9 -1 -44 9.7 4.3 -1 Negative 8 88 -1.5 -40 -9.7 4.3 13 -11 You should use polymorphism in your code by creating an array of FloatArray* in main.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: Write C++ application with several functions that deal with a two-dimensional array of positive…

A: The problem shows a need of printing a 20*20 matrix having random numbers from 1 to 1000. It then…

Q: Write a function recursively_count_vowels() which accepts a pointer to a string, and any other…

A: //include the required header files #include<stdio.h> #include <string.h> //declare…

Q: Given an integer array arr and its size passed as parameter to a function. Function returns the sum…

A: Given: Integer array arr and its size passed as parameter to a function. Requirement: Write a…

Q: One dimension array in C:Create an array of 100 integer elements and initialize the array elements…

A: The objective of the question is to create an array of 100 integer elements in C, initialize them to…

Q: C Programming Write function updateHorizontal to flip the discs of the opposing player, it should…

A: Algorithm: Step 1: Define function checkHorizontal(). Initialize flank to 0 and count to 0. Step 2:…

Q: Group Anagrams when given an array of strings in C++ Example: Input: ["eat", "tea", "tan", "ate",…

A: /** File : group_anagrams.cpp*/…

Q: 51- Write a function which accepts two array of integers (like arr1 anc of the same size (100), then…

A: here in this question we have asked to write a c++ program which take two array and add its element…

Q: Write a code which prints out a column vector by using the row vector containing the digits in prder…

A: Start Create row vector with each digit in Student Number Apply transpose to make it column vector…

Q: C++ When the program is initially started, it should load the list of words into an array from the…

A: Here is the c++ code of the above problem. See below steps for code.

Q: In C++: Define a function that reads input 5 integers from the user, stores them in a vector, and…

A: Define a C++ function that reads input 5 integers from the user, stores them in a vector, and then…

Q: Data Structures the hasBalancedParentheses () method. Note: this can be done both iteratively or…

A: NOTE: Only function is provided as per the question, and not the complete code. c++ function code:…

Q: Describe partial initialization of arrays during declaration.

A: Partial initialization of arrays Partial initialization is a non-standardized terminology which…

Question

Don't use vector array .using ifstream and ofstream.

C++ program

The only input to your program is the names of the input txt file
and output txt file name. The input text file will have exactly
10 lines. Each line will have:
1- One of 5 words: Array, Front, Sorted, Positive, or Negative.
This indicates the type of array to create.
2- An integer which indicates the number of elements in the
array.
3- The elements to be entered into the array.
The following is an example content of the file:
Sorted 10
8.4
-4
2.3
11
80
7
77
95
12
100
Array 7
Front 5
3.4
9
4.7
3
9
8.
4
7.9
0.44
1
Array 6
Sorted 4
45
23
8.5
3.98
4
2.5
90
4
111
Sorted 8
7
4
1.1
3.2
88
Array 6
Front 3
13.5
7.6
9.
33
1
7
1.5
Positive 7
7.9
-1
-44
9.7
4.3
-1
Negative 8
88
-1.5
-40
-9.7
4.3
13
-11
You should use polymorphism in your code by creating an array
of FloatArray* in main.
Read from the txt file and allocate your objects according to the
type of array and fill the arrays using the extraction operator
>>.
After finishing reading the file, you should write your arrays to
another text file using the insertion operator<<.
The output file for the above text file will be:
10|
7|
5|
6|
4|
8|
6|
3|
3|
4|
-4
2.3
7
8.4
11
12
77
80
95
100
3.4
2
9.
4.7
3
1
0.44
7.9
4
8
45
23
8.5
3.98
4
2.5
4
90
111
1.1
3
3.2
4
7
9
88
13.5
7.6
33
1
1.5
5
7
4.3
7.9
9.7
-40
-11
-9.7
-1.5
Where each line begins with the number of elements followed
by the character T', a tab, then the array elements separated
by tabs.
Don't forgot to deallocate by deleting your objects in main after
finishing.
A sample run is found below:
Enter the name of the input file:
in.txt
Enter the name of the output file:
MyOut.txt
Process returned 0 (0xe)
Press any key to continue.
execution time : 16.048 s

Task
Declare and implement 5 classes: FloatArray, SortedArray,
FrontArray, PositiveArray & NegativeArray.
1- The FloatArray class stores a dynamic array of floats and its
size. It has:
A parameterized constructor that takes the array size.
- An add method that adds a float at the end of the array.
- Overloading for the insertion operator << to write the array to a
file (ofstream)
- Overloading for the extraction operator >> to read the array
elements from the file (ifstream) and add them to the array.
- A destructor to deallocate the array
2- The SortedArray inherits from FloatArray. It has:
- A parameterized constructor that takes the array size.
- An add method that adds a float at the right place in the array
such that the array remains sorted with every add. Don't add to
the array then sort but rather add in the right place.
3- The FrontArray inherits from FloatArray. It has:
A parameterized constructor that takes the array size.
An add method that adds a float at the front of the array.
4- The PositiveArray that inherits from SortedArray. It has:
A parameterized constructor that takes the array size.
- An add method that adds a float to the array only if it's a
positive number. It then uses the add method of SortedArray.
5- The NegativeArray that inherits from SortedArray. It has:
- A parameterized constructor that takes the array size.
- An add method that adds a float to the array only if it's a
negative number. It then uses the add method of SortedArray.
The only input to your program is the names of the input txt file
and output txt file name. The input text file will have exactly
10 lines. Each line will have:
1- One of 5 words: Array, Front, Sorted, Positive, or Negative.

Process by which instructions are given to a computer, software program, or application using code.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step 5

Trending now

This is a popular solution!

Step by step

Solved in 5 steps with 3 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

ON MATLAB PLS
Declare 2D array whose size and elements must be according to the desire of user then perform the following functions on it Display a lower triangular matrix. Find the sum of an upper triangular matrix. DO IT IN C++
c++ programming Initialize a string array named person with your first, middle andlast name as separate elements. Print the middle name from the array. Iterate to print all values of the array. Output Example WilliamJohn William Henry
Please complete this program in C++ Please enusre that there is plenty of comments. PLENTY even if unessessary. Please include screenshots of actual code, screenshots of output, and code in the browser so I can copy and paste. Thank you.
C++ program: Write a function that accepts an array/vector as an input and calculate the sum of all the elements in the array. This function must use recursion to achieve this. Show code: Please show all steps.
Is there any advantage to utilising vectors instead of arrays?
Answer in C++ code please! (Duplicate Elimination with vector) Use a vector to solve the following problem. Read in 20 numbers, each of which is between 10 and 100, inclusive. As each number is read, validate it and store it in the vector only if it isn't a duplicate of a number already read. After reading all the values, display only the unique values that the user entered. Begin with an empty vector and use its push_back function to add each unique value to the vector.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Create a flowchart for this program in c++, #include <iostream>#include <vector> // for vectors#include <algorithm>#include <cmath> // math for function like pow ,sin, log#include <numeric>using std::vector;using namespace std;int main(){ vector <float> x, y;//vector x for x and y for y float x_tmp = -2.5; // initial value of x float my_function(float x); while (x_tmp <= 2.5) // the last value of x { x.push_back(x_tmp); y.push_back(my_function(x_tmp)); // calculate function's value for given x x_tmp += 1;// add step } cout << "my name's khaled , my variant is 21 ," << " my function is y = 0.05 * x^3 + 6sin(3x) + 4 " << endl; cout << "x\t"; for (auto x_tmp1 : x) cout << '\t' << x_tmp1;//printing x values with tops cout << endl; cout << "y\t"; for (auto y_tmp1 : y) cout << '\t' << y_tmp1;//printing y values with tops…
How do you put a 2D array code into a function? (C++ only)
python use the "get_first_name" function in the "names" module and create a list of 8 first-names.
What are some instances of asynchronous, synchronous, and isochronous connections? Are there any significant differences between these connections?