An outbreak of E. coli occurred after a UofSC alumni luncheon which was attended by 200 people. 120 attendees exhibited GI symptoms within 10 days of the luncheon. 4 attendees died from E. coli within a mont Calculate the case-fatality rate for E. coli during this outbreak. Express as a percentage and round to the nearest whole number. Include only the numerical answer (no units) in the answer box.
Q: give atleast 3 diagnosis for this case scenario. Data Gathered : A 26-year-old woman comes to the…
A: In the given scenario, a 26-year-old woman is 18 weeks pregnant and suffering from abdominal pain.…
Q: 1. What is the diagnostic significance of each of these hepatitis B antibodies? 2. Why is it…
A: The diagnostic significance of the different types of hepatitis B antibodies is that they help us in…
Q: What complication should the LPN suspect when signs and symptoms of redness , warmth , and pain at…
A: When administering IV medications or IV fluids, it is important for the nurse to look for signs of…
Q: https://www.youtube.com/watch?v=c06dTj0v0sM 1. In not more than 100 words, define nutrition and its…
A: The given video has properly depicted the role of good nutrition in a healthy life and its effects…
Q: Discuss any two current trends and issues in nursing and health care with examples, and explain how…
A: Trends in nursing means a change or development in the field of nursing profession. Issues in…
Q: wer. A common characteristic of a site of infection, such as a pimple on the skin, is pus. What is…
A: As we know The immune system plays an important role in the human body for it. It is involved in…
Q: What is Community Health Nursing?
A: The community consists of a group of people who are sharing the common characteristics or interest…
Q: The endogenous ligand for an ion channel causes the influx of 50 Na+ ions per second. This ion…
A: antagonist:A ligand that binds to a receptor and changes the receptor's state to cause a biological…
Q: How can structural racism prevent optimal health for all?
A: Racism means inequality between people. It is believed that some people are better than other…
Q: Identify and explain how the intrinsic characteristics of a child with the Specific Language…
A: Spectrum refers to a wide range of symptoms, skills, and levels of impairment that affect a child…
Q: Order: clindamycin (Cleocin) 1.2 g IM qid. Supply: clindamycin (Cleocin) 1200 mg vial. Reconstitute…
A: Clindamycin is an antibiotic that is given to patients were suffering from an active infection and…
Q: How can the nurse affect school violence.
A: Violence is the intentional use of physical force or power against another person or a group or…
Q: Discuss the purpose of fluid and electrolyte therapy for a patient with diabetic ketoacidosis
A: Diabetic ketoacidosis(DKA): It is characterized by insulin deficiency which can lead to…
Q: statements is true? oxygen binds to hemoglobin more strongly near alveoli the strength of oxygen…
A: As we know Likely Hemoglobin is a protein molecule that is found in the red blood cells mainly…
Q: 2. The Nurse managerial must have the three competencies of leadership except:
A: Question. The Nurse managerial must have the three competencies of leadership except: Answer.…
Q: 107. A 23-year-old woman comes to the physician because of a 3-hour history of sharp left chest wall…
A: Chest pain that is sudden or stabbing, especially while inhaling deeply or coughing, is a common…
Q: A Pediatric Patient with a body mass of 80.0 tb is Prescribed propranatal for asshythmia, the…
A: Given data: Body mass = 80.0 lbs1 lbs = 454 gramsTherefore,80 lbs = 454 x 80 grams = 36320 grams…
Q: . Community empowerment is an important aspect in the work of a community health nurse. In CO the…
A: One must first give someone more control and understanding of their situation before one can empower…
Q: The doctor orders adiministration of a drug at 120 mg per 1000 mL at 400 mL/24 hr. How many mg of…
A: Given that 400 mL is given in 24hrs. So, that means in 24 hours, 400 mL is given. So, in 8 hours,…
Q: Please help me to select ALL the letter of correct answers. 1. Which of the following best…
A: 1)C It is preferable to use a surgical scrub preparation that provides a film of protection lasting…
Q: After confirming a case of measles in SC, health department staff contact local healthcare providers…
A: Active surveillance is said to be done when the healthcare authorities provide stimulus to the…
Q: 5.A person Latasha’s doctor prescribed Amoxicillin for her to take for 10 days upon her diagnosis of…
A: Antibiotics These are either synthetic or semisynthetic agents that prevents or reduces the growth…
Q: Put the DISEASE across the top of the 2x2 table and the Exposure down the side • Study design…
A: Introduction:- According to the NIH (National institute of health) found that the lung cancer is…
Q: Discuss polycythemia vera in terms of complete blood count parameters
A: Polycythemia vera, a myeloproliferative neoplasm is a chronic condition and is life threatening.…
Q: dvantages and limitations of most marital education programme?
A: We know Any program which is launched keeps in mind the place and the target audience, for example,…
Q: Data: Subjective: “I haven’t been eaten for the last 2 days” as verbalized by the patient Give me an…
A: Subjective data consists of an expression of chief complaints in patient's own words. It is…
Q: True or false? Passive surveillance refers to provider-initiated surveillance where healthcare…
A: True
Q: How the use of government clinical databases can help researchers study different diseases.
A: Clinical databases are observational data which is taken from the patients who are categorised under…
Q: 59. A 20-year-old woman is participating in a study of skeletal muscle blood flow during dynamic…
A: The answe will be D) immediately after S2
Q: 1. What do you see? 2. What do you think about that?
A: Nutrition is the essential part where it helps to do physiological and biochemical process by…
Q: 112 A 53-year-old woman comes to the emergency department because of sharp, pleuritic right chest…
A:
Q: Referring to the following hydrostatic and oncotic pressures across a muscle capillary wall, which…
A: Capillary hydrostatic pressure is the outward pressure applied by the stream of blood on the vessel…
Q: Need help for this. Thank you. If you have an NCP regarding this case. Please share it with me. Or…
A: Case summary: A 68 year old, elderly patient, Mr.Alcot is diagnosed with Right middle lobe…
Q: Patient X- diagnosed with G6PD deficiency since birth, was prescribed with cotrimoxazole for UTI.…
A: Co-trimoxazole is a drug that is usually not prescribed in glucose-6-phosphate dehydrogenase (G6PD)…
Q: 15. Your 172 lb. female patient has an order for dobutamine 5 mcg/kg/min IV to start at 1300. The…
A: Answer. Given data :---- Weight of patient = 172 lb. Dobutamine is ordered = 5 mcg / kg / minute.…
Q: nt What is the im
A: POCT in the laboratory: It stands for Point-of-care. This is medical diagnostic testing.
Q: Newborn care and nutritional needs summary
A: An infant who is under 28 days of age is considered a newborn. It is the period of first four weeks…
Q: efly please Discuss the legal and ethical issues for a nurse who is asked by a Nurse Manager to help…
A: Introduction As we know Ethics is the study of good motives and character of it. It is a concern…
Q: 9. An Infant weighs 1400gm, TFI 140cc/kg/day, HAL 7.6ml/hr, Intralipid 0.6ml/hr, start feeding 3cc…
A: Weight of infant = 1400gm Recommended total fluid intake (TFI) = 140cc/kg/day Current infusion rate…
Q: Explain thoroughly, If nursing theories were not formulated, what do you think will happen? Cite an…
A: Nursing theories helps shape the parameters of patient care delivery. Without these theories in…
Q: Z7
A: We know that Muscles are the soft tissue found in our body. Muscles work to create strength and…
Q: Give an example for each of the following: 1. NURSING AS A PROFESSION 2. NURSING AS A DISCIPLINE
A: A profession is an occupation or a job that require extensive training and education. Discipline…
Q: HCG QUESTIONS 1. Where is hCG produced in the female body? 2. How is hCG differ from other gonadal…
A: Hello dear , according to answering guidelines I am providing answer of first three question. Please…
Q: describe the importance of maintaining IV sites?
A: IV Sites: Peripheral intravenous (IV) catheters are put into tiny peripheral veins to give access to…
Q: hat is he Classification (Chemical and Therapeutic) of Gemfibrozil 2. Drug-drug or drug-food…
A: Cholesterol in the blood circulation do not travel via the body on its own and combines with the…
Q: List the mechanism of pernicious anemia
A: Pernicious anemia is a type of megaloblastic anemia that results from the deficiency of…
Q: 4. This Nurse Manager wanted to control her subordinates, she gives strict direction and was stern…
A: Laissez fair is a type of economic system in which there is a minimum amount of influence from the…
Q: Dan "threw out his back" after lifting heavy furniture and complained of pain radiating down the…
A: When engaging in physical exercise, the lower back throws out most frequently. Pain can range in…
Q: Briefly discuss the manifestations that are common to both Crohn's disease and ulcerative colitis…
A: Crohn's Disease and Ulcerative colitis are the inflammatory bowel diseases(IBD) that affect the…
Q: Taking the broad categories of stimulants, depressants, and hallucinogens, please explain the…
A: Depressants are drugs that slow down the function of the central nervous system. They can induce…
22.
Step by step
Solved in 2 steps
- https://youtu.be/kUlKRIMxpZQ?si=HXom3VXfbwAeMNPl Answer the questions after watching the video above and please cite any other sources that is used. Thank you How do public health officials work together to solve the issues? How do you investigate the outbreak? What do you need to do?Most hospitals use hand sanitizers that claim to “kill 99.99% of illness causing germs”. What are some possible reasons that 0.01% of germs (germs = microorganisms and viruses) not affected by hand sanitizer? (In your answer, you should state what hand sanitizer is made of, and the mechanism by which it kills “germs”.Five human infections (or resulting diseases) are presented below. For each one, find three matching terms from the associated word bank (see below). Some terms can be used more than once. Each term should be used at least once. 1. Pneumocystis pneumonia in advanced AIDS patient 2. Plague originating in a bite from Yersinia pestis-infected rat flea 3. Undiagnosed Mycobacterium tuberculosis lung infection 4. Infection of meninges caused by Neisseria meningitidis 5. Digestive tract infection with the water pathogen Vibrio cholerae WORD BANK Acute Infection Chronic Infection Asymptomatic infection Secondary infection Zoonotic Infection Airborne Infection Bacteremia Viremia Contact transmission Vehicle transmission Vector transmission Opportunistic pathogen Breaching of the blood-brain barrier Non-living reservoir
- You are preparing your hospital staffing plan for the upcoming flu season. You have access to the CDC's Flu Weekly updates but need to better understand how the flu season has impacted your hospital in the past. What analysis will you ask your epidemiologist to conduct so that you will be able to prepare a more accurate staffing plan for the upcoming flu season? Organize your request in an email format. Make sure to list specific epidemiologic data and information (understand the data type and data processing)you need to make your decisions .can you explain why Bacillus anthracis can be pathogenic in a mouse and not be fought off by the immune system? I need help finding the answer in the article and explain in short answer link to article: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/Answer the following questions in complete sentences and paragraphs. Draw the diagram by hand: Diagram the 5 step pathogenesis cycle for coli O157:H7, an extracellular, intestinal pathogen acquired by consuming contaminated food/water. Be sure to include the role of exoenzymes and the Shiga exotoxin in your diagram. Explain the pathogenesis of Listeria monocytogenes. Be sure to include temperature regulation, intracellular growth, and at risk groups in your discussion.
- Can you please help me answer the following questions in full details and in your own words. I really need them all. 1. History of Coronaviruses and Humans ( A few sentences and in your own words) 2. The Epidemiology of Covid ( A few sentences and in your own words) 3. Public Health Response to Covid during the Early pandemic ( A few sentences and in your own words) 4. Layered Mitigation Strategies of covid ( A few sentences and in your own words)This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acidsMake a comment on Antimicrobial Resistance (AMR), regarding the impact on the treatment of infections caused by bacteria with AMR and future consequences of this "Silent Pandemic". 7 line paragraph
- A 19-year-old woman presented because of the recent onset of breakthrough bleeding. She has been taking the same oral contraceptive Pill for two years, she has not forgotten any pills or had diarrhea or vomiting. She has been with her current sexual partner for four months and has recently stopped using condoms as additional protection. She is otherwise well. On examination the vulva and vagina are healthy and there is no inflammation. There is a small cervical ectropion and profuse mucus and pus discharge from the cervix. There is no tenderness on bimanual vaginal examination and no masses palpable. An endocervical swab and urine test was administered.write out a detailed summary on Salmonella. Questions below will help you frame your summary. Please describe the bacterium. What is its shape and size? Is it Gram-positive or negative? Pictures are always fun! If you can find a microscopic image – include it. What is/are the reservoir(s)? e.g. water, food, human, etc. Are there parameters needed for infection? (Temperature, pH) What is/are the mode(s) of transmission. If it's foodborne - is it linked to a specific food? How many cases occur each year? In the US and/or worldwide and/or in the County where you live Has it caused any outbreaks or epidemics? Thank you-Please select all of the statements that apply to chlamydial infections. (NOTE: Please change all question marks to checkmarks for correct answers or empty boxes for incorrect answers.) Check All That Apply Caused by Chlamydia trachomatis, a rod-shaped bacterium. Caused by Chlamydia trachomatis, a rod-shaped bacterium. Causative agent is an obligate intracellular parasite. Causative agent is an obligate intracellular parasite. Causative agent has two forms: elementary body and reticulate body. Causative agent has two forms: elementary body and reticulate body. Causative agent has two stages: cercaria and miracidium. Causative agent has two stages: cercaria and miracidium. Newborn babies of infected mothers can develop chlamydial eye infections.