After translocation occurs, the AUG codon will move into the A site. When a third amino acid is added on to the dipeptide chain, that reaction will be thermodynamically favorable.

Q: Which of the following statements about translation is false?     In eukaryotes, the 5' cap and…

A: In molecular biology, the process by which the gene information in the DNA gets converted into a…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…

Q: The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it…

A: Introduction  In the protein translation process, the key role is played by the tRNA which…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Name the enzyme responsible for binding of aminoacid to trna?

A: Ribonucleic acid (RNA) is a biomolecule that plays important role in coding, decoding, and…

Q: You are observing the translation process in a eukaryotic cell that has been exposed to an unknown…

A: Translation is the process by which the genetic information encoded in mRNA is used to synthesize…

Q: An mRNA encodes a polypeptide that is 312 amino acids in length. The 53rd codon in this polypeptide…

A: The translation is the second part of the central dogma of molecular biology: RNA → Protein. It is…

Q: Which of the following types of mutation that changes the mRNA sequence after the codon that…

A: Frameshift mutation is a type of mutation that changes the reading frame via the indel mutation…

Q: Provide the DNA sequencce  (not RNA sequence) for the Start Codon and 3 Stop Codons.

A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…

Q: Explain the function of the Shine-Dalgarno sequence in prokaryotic protein translation. Where is it…

A: The process by which prokaryotic cells, such as bacteria, synthesise proteins based on genetic…

Q: and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into…

A: Any abrupt changes in DNA nucleotide is called muttaion.Depending on where the changes occurred…

Q: Use the numbers below to indicate the correct order of events (from left to right) during the…

A: Hi, Thanks For Your Question.  Answer : Correct Sequence Is 3 4 2 1 5.

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Transcription and translation are separate processes in gene expression; however, they have…

A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: A point mutation that changes a codon specifying an amino acid into a stop codon is called a

A: Point mutations are those which substitutes one nucleotide (within) a codon into another. Due to…

Q: Give two reasons why a point mutation in the codon for methionine (Met) would likely be more serious…

A: Point mutation is a mutation where a single nucleotide is changed i.e. insertion, deletion or…

Q: The synthesis of a protein requires that the amino acids that constitute the growing polypeptide…

A: In the intricate dance of cellular processes, protein synthesis takes center stage, orchestrating…

Q: During ______, the amino acid connected to the tRNAat the P site forms a peptide bond with the amino…

A: During translation, polypeptide chain is produced in ribosome by adding amino acids one by one.

Q: Describe the charging process of a tRNA.

A: A form of RNA molecule known as tRNA aids in the translation of a mRNA into a specific protein.…

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.  

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.