Answered: (a) Why can there be multiple codons…

(a) Why can there be multiple codons for an amino acid? Why would this have evolved? (b) What is the advantage of Illumina Next Generation Sequencing?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 2QP: Why do you think nucleic acids were originally not considered to be carriers of genetic information?

See similar textbooks

Related questions

Q: Why is gene cloning important?

A: Gene cloning is the process in which any gene of interest is amplified, that is, several copies of…

Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…

A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…

Q: Why do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas…

A: A cDNA (complementary deoxyribonucleic acid) library is a combination of cloned cDNA fragments…

Q: What are the types of transposons? Explain how transposons contribute to genome evolution.

Q: If you were working on the Human Genome project and trying to distinguish genes from transposons,…

A: The gene is the sequence of nucleotides and is the functional unit of heredity. Genes contain…

Q: Since we have known the sequence of the human genome for almost two decades, why sure of the total…

A: Because it is difficult to tell where one gene ends and another begins . Another difficulty is same…

Q: You have isolated a new bacteriophage and determined that the composition of its is nucleic acid is…

A: The double-stranded helical structure of DNA is maintained primarily due to the hydrogen bonds…

Q: What is a BLAST search? a. A mechanism for aligning consensus regions during wholegenome…

A: BLAST or Basic Local Alignment Search Tool, is a program used in bioinformatics for the comparison…

Q: If I clone a complete eukaryotic gene, including the eukaryotic promoter region, ligate it into a…

A: Transformation is the process in which a bacterium takes up DNA from the environment, that has been…

Q: Clearly, all humans have variations in their DNA sequences. How is it possible to sequence the human…

A: Answer- All the organism have certain amount of similarities in the DNA sequnece. In all the human…

Q: What were the two major goals of the Human Genome Project? Select all that apply. a to isolate…

A: Introduction :- The Human Genome Project was an international scientific research project aimed at…

Q: The following DNA sequence is part of one exon and contains the beginning of a gene’s open reading…

Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Add an A before codon 3 or delete the middle base in…

A: A frameshift mutation occurs in the DNA sequence due to either addition or deletion of DNA bases…

Q: How does the universality of the genetic code make recombinant DNA technology possible?

A: According to the concept of universality of the genetic code, all living creatures' proteins are…

Q: How does molecular biology paved way for the development of the DNA fingerprinting technique? and…

A: DNA fingerprinting was invented in 1984 by Professor Sir Alec jeffreys after he realised that…

Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…

A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…

Q: How the Sequencing Technologies Have Progressed Rapidly ? Explain about this ?

A: Early efforts at sequencing genes ere troublesome, when Gilbert and Maxam reported the sequence of…

Q: Annotation involves identifying genes and gene-regulatory sequences in a genome. List and describe…

A: Annotation of a sequence is usually done by comparing it, often using BLAST with the known sequences…

Q: I wanted to know where in the concepts of genetics 12th edition book can I find the answer to my…

A: The genetic code is a set of laws that define how DNA's four-letter code is converted into amino…

Q: You have isolated a transposable element from the human genome and have determined its DNA…

A: A transposable element which is also known as jumping gene is a DNA sequence that plays a major role…

Q: The genome of what free living organism was first fully sequenced, and when?

A: Introduction:- The order of DNA nucleotides, or bases, in a genome—the order of As, Cs, Gs, and Ts…

Q: What is the Human Genome Project’s plan for human DNA sequencing?

A: The Human Genome Project was an international research initiative to classify the DNA sequence of…

Q: What did we learn about the size of our genome? Why was it surprising

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: Give the biological information in DNA generate an enormous diversity of living organisms?

A: Biodiversity is referred to as an occurrence of different times of ecosystems, species with whole…

Q: How did the Human Genome Project result in more rapid, lessexpensive DNA-sequencing technology?

A: The process of determining the sequence of nucleic acid that is the nucleotide order in DNA is…

Q: What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: If pET32a(+) is digested simultaneously with BamHI and BclI, 5.1. How many fragments are created?…

A: pET-32 is a unique sequence outlined for cloning and high-standard peptide sequences expression.

Q: Why did DNA, rather than RNA, evolve to be the carrier of genetic information in cells?

A: This is one of the primary dissimilarities between DNA and RNA. DNA (Deoxyribonucleic acid) is the…

Q: A fairly conserved gene is compared between a human, a chimpanzee, a bear and a banana. How would…

A: A fairly conserved gene is compared between a human, a chimpanzee, a bear and a banana.

Q: Do you think DNA deserves all the glory accorded to it as the fundamental unit of the genome?

A: DNA or Deoxyribonucleic acid is one of the two classes of Nucleic acids. Two types of nucleic acids…

Q: whose descendant sequences are found in all people now on the earth?

A: An ancestor is defined as the actual or hypothetical form from which an organism has developed or…

Q: What is Sanger sequencing? Why do we use ddNTP? How to read a DNA sequence gel? c. What is a cDNA…

A: Your question contains multiple sub-parts, and as per our policy, we only answer the first three…

Q: What are the types of transposons? Please explain in detail how transposons contribute to genome…

A: Some mobile genomic components have been named as mobile genetic elements or transposable elements…

Q: What does the number of differences in rRNA sequences between two species represent?

A: Introduction Ribosomal RNA (rRNA) Is A Molecule Found In Cells That Is Part Of The Ribosome, A…

Q: If RNA played a key role in the origin of life,why do cells now use DNA for information storage and…

A: Introduction DNA and RNA are the main genetic material found in all the species irrespective of…

Q: Apart from genome size, what factors make completeassembly of a eukaryotic genome more difficult…

A: Chromosomes are thread-like structure, which are composed of nucleic acids and protein. They are…

Q: If most of the DNA in Bacteria and Archaea is coding DNA and much of the DNA in higher plants and…

A: Bacteria have various shapes which ranges from spheres to rods and spirals.Bacteria are among the…

Q: How can you tell whether DNA sequences from two sources are similar by chance or instead by common…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Why is RNA sequencing important?

A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…

Q: Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: Three human genomic DNA fragments (A, B, and C) are sequenced and revealed the following: fragment A…

A: DNA or Deoxyribonucleic acid is the genetic material that is found in most higher organisms. It is a…

Q: "The Quest to Create a Synthetic Human Genome" Define this ?

A: A genome is the complete set of genes or chromosomes present in the cells of an organism. A gene is…

Q: How much human sequence has been produced so far?

A: Genome refers to the complete genetic compliment comprised in an organism specific cell, tissue, or…

Q: What can exome sequencing do for you?

A: The sequencing of the nucleic acid is the process through which the exact sequence of the nucleotide…

Q: What is the significance of digesting the 16S rRNA product in 16s gene sequencing?

A: The 16S rRNA is a structural component of the 30S ribosomal subunit of bacteria and archea.

Q: Why is electrophoresis important in Molecular Biology

A: The elctrophoresis is a general term that depicts the migration and partition of charged particles…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

(a) Why can there be multiple codons for an amino acid? Why would this have evolved?

(b) What is the advantage of Illumina Next Generation Sequencing?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

GENETICS if/when a "whole-genome shotgun" approach is used for DNA sequencing, which of the following is MOST likely to create problems during the assembly of a complete genomic sequence? a) long sequence reads b) a high degree of coverage/ redundancy in the sequence data c) the presence of repetitive DNA d) not enough contigs e) all of the above
The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.
Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA.
The figure below shows a polynucleotide:a) Label the 5' and the 3' end of the sequenceb) If a nucleotide were added to this polynucleotide, which end would it be added to?c) Is this an RNA or DNA strand? How do you know?
The dideoxynucleosides ddATP, ddTTP, ddGTP, and ddCTP were important in DNA sequencing because they (a) cause premature termination of a growing DNA strand (b) are used as primers (c) cause the DNA fragments that contain them to migrate more slowly through a sequencing gel (d) are notaffected by high temperatures (e) have more energy than deoxynucleotides
The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following questions: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain your answer. b) Would methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove?
GENETICS The modified "dye terminator method for DNA sequencing represented a major improvement over Sanger's original method because ( among other things) it does NOT require a) a DNA primer b) DNA polymerase c) the use of four separate sequencing reactions for each template d) the use of electrophoresis to separate DNA chains based on size e) the used chemically modified dNTPs f) all of the above
Which of the following is false when considering repetitive DNA? a) STRs are the same as microsatellite DNA. b) STRs are the same as SNPs. c) STRs can occur in introns and in regions between genes. d) Tandem means two or more repeats next to each other.
Why do you think nucleic acids were originally not considered to be carriers of genetic information?
Which of the following statements most accurately describes the action of the enzyme RNA polymerase?Select one 1.) RNA polymerase will transcribe only the exons by skipping over the introns within a eukaryotic gene sequence 2.) RNA polymerase will transcribe both DNA strands, moving in the 3' to 5' direction for one strand and 5' to 3' on the other 3.) RNA polymerase will transcribe both DNA strands, but only one RNA molecule will be used during translation 4.)None of the statements accurately describe the function of RNA polymerase
Short tandem repeat sequences (STRs) are a) used for DNA profiles b) repeat sequences present in the human genome c) highly variable in copy number d) all of these e) none of these
a) What is gene mutation? and what are the causes and consequences of gene mutation? b)With illustrations, write concisely on gene mutation with emphasis on (i) Point Mutation (ii) Silent Mutation (iii) Frameshift Mutation