A Sanger product seque mplate presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNA

Q: What is the polypeptide that will be formed from the following DNA sequence?  Template DNA…

A: In molecular biology complementary base pairing or complementarity is a reletion between the two…

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…

A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…

Q: the difference between the chemical structures of DNA & RNA and state the said difference in a short…

A: Both the DNA and RNA are made of nucleotides , containing a fivecarbon sugar backbone (pentose) , a…

Q: Label the following -phosphodiester bond -AT base pair -hydrogen bond -deoxyribose sugar -GC base…

A: DNA is a nucleic acid which also acts as genetic material. It is made up of deoxyribose, a pentose…

Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…

A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: According to Watson-Crick base pairing rule, adenine (A) pairs with thymine (T) while guanine (G)…

Q: DNA polymerase I DNA polymerase II DNA ligase Primase RNA primer 5' Lagging strand 3' 3' Okazaki…

A: The process of copying of double stranded DNA by the application of several Enzymes and proteins…

Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Illustrate a short DNA segment showing the bonds formed between  complementary base pairs  as well…

A: Introduction: The two types of nucleic acids are RNA and DNA. The nucleic acid serves as a…

Q: Match the proteins with their function in DNA replication. unwinds DNA at replication fork forms…

A: The correct matching of proteins with their functions in DNA replication:Unwinds DNA at replication…

Q: The DNA sequence you use will be the following:  T - A - G - C - C - A.  You will need to make the…

A: chargaff's rule states that in DNA sequence in  complementary strands the Adenine will form a bond…

Q: Answer the following questions based on the given the sequence of nucleotides in a DNA molecule…

A: Given:- The sequence of nucleotides in a DNA molecule:- 5'…

Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…

Q: What would happen if we take out a nucleotide (frameshift)? Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-T…

A: ACCORDING TO THE CENTRAL DOGMA, DNA IS TRANSLATED TO mRNA WHICH GETS TRANSLATED TO PROTEINS. THE…

Q: strand and its complementary : 5'-ATTACAG-3' umber of hydrogen bonds between strands: + TOOLS x10

A: The nucleotides forming each DNA strand are connected by noncovalent bonds, called hydrogen bonds.…

Q: Determine the characteristics of this piece of double-stranded DNA.   GTCTTTTACTTGAAT…

A: DNA is the double helical structure that contains the information that help in inheritance. The…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains…

Q: Identify and mark each of the following on the portion of DNA undergoing replication: replication…

A:

Q: Instructions: Put the following terms into a word map to explain how they are interrelated for DNA…

A: DNA has the ability to self replicate. It undergoes semi-conservative replication. DNA Replication…

Q: In 1984, Carolyn Greider was using out the enzyme called telomerase that had the ability to add…

A: Chromosomes are the structures formed by the organised arrangement of the DNA molecules located…

Q: Draw the following segment of DNA molecule. Show the important covalent and non-covalent…

A: DNA (deoxyribonucleic acid) is composed of a chain of deoxyribonucleotides. These…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: Question Image hown t nallest Q. A gel from gel electrophoresis is shown below. Which DNA fragment…

A: A technique that is used for the separation of fragments of DNA on the basis of charge and size is…

Q: On the diagram of this DNA molecule, match the letters to the corresponding components: (should only…

A: In the diagram below DNA is shown. DNA is made up of a monomer called nucleotide. Each nucleotide…

Q: iginal mplate) HA denine Thymine Cytosine Guanine nzymes and structures to label: hromosome…

A: A chromosome is a long DNA molecule with part or all of the genetic material of an organism.Most…

Q: Which of the following statements about DNA and RNA is CORRECT? Select an answer and submit. For…

A: Nucleic acids are polymeric molecules with a long chain. The monomer or repeating unit is known as a…

Q: Write a DNA structure having 8 nucleotides.

A: Deoxyribose Nucleic Acid is double stranded polymer of purines and pyrimidines. As per Chargaff's…

Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…

Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: What enzyme breaks the H-bond between nucleotides of DNA?   Group of answer choices DNA gyrase DNA…

A: DNA is known as deoxyribonucleic acid. DNA act as the genetic material in most organisms present on…

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Plasmids are double-stranded circular DNA molecules. Due to their small size and stability, these…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand?…

A: As per the general rule, the base adenine (A) always pairs with thymine (T) and the guanine (G)…

Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…

A: Introduction  A polynucleotide consisits of many nucleotide monomers. DNA is made up of…

Q: Indicate where each of the following processes occurs (nucleus, cytoplasm or mitochondria).…

A: In humans, the genetic information present in the cell is in the form of the Deoxyribose Nucleic…

Q: Draw a generalized nucleotide. Just put “base” instead of drawing the actual base. Label the carbons…

A: Nucleotides are the monomer units of biological polymers nucleic acids (DNA and RNA). They composed…

Q: Drag an arrow in the appropriate direction of travel for DNA Helicase Replication fork Trihoshate…

A: The course of replication is done with the assistance of various enzymes, for example, helicase, DNA…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.