**Transcription for Educational Website****Genetic Code Chart**The genetic code chart displayed is a table that translates RNA codons into their corresponding amino acids. It is arranged such that the first, second, and third letters in the codon determine the resultant amino acid. - **Rows**: Structured by the first letter of the codon (U, C, A, G).- **Columns**: Divided by the second letter of the codon within four sections.- **Cells**: Each cell then specifies the third letter of the codon to determine the specific amino acid or stop signal.**Codons and Amino Acids Mapping** (selected examples):- UUU, UUC: Phenylalanine (Phe)- AUG: Methionine (Met), serves as the start codon- UAA, UAG, UGA: Stop codons, signal termination of protein synthesis**Problem Description**A mutation occurs during replication, producing a new DNA sequence: 3'-ATG-5'. The task is to determine the RNA codon transcribed from this DNA sequence and identify the corresponding amino acid using the genetic code. To solve this, match each DNA base with its complementary RNA base:- DNA "A" pairs with RNA "U"- DNA "T" pairs with RNA "A"- DNA "G" pairs with RNA "C"This gives the RNA sequence as 5’-UAC-3’. According to the genetic code chart, the RNA codon UAC corresponds to the amino acid Tyrosine (Tyr).

The genetic code is a triplet code called a codon. The indicated amino acid can be specified by more…

A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5' What is the codon on an RNA strand transcribed from this series of nucleotides? Which amino acid results from this codon? Use the genetic code to answer this question.

A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5' What is the codon on an RNA strand transcribed from this series of nucleotides? Which amino acid results from this codon? Use the genetic code to answer this question.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?
The following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…
What is the mRNA strand of the following DNA (coding) strand: ATGGCTAACCTTGTA
DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in RNA!) Amino acid Use the mRNA with the Genetic Code. Use the mRNA with the Genetic Code. Answer the questions below. Questions How many nucleotides would be needed to code for a protein that has 100 amino acids? Using the Genetic Code in Table 6.3, write all of the possible codons that signal the start and end of a gene. Start: End: An amino acid sequence of a protein molecule includes methionine, lysine, serine and glycine. Show each different codon that could result in each of these amino acids. You will have more than one codon for all of them except methionine. Amino Acids All Possible Codons Methionine Lysine Serine (Look carefully. There are six possibilities) Glycine Question 3 illustrates the redundant nature of the genetic code. Can you think of an advantage of having several codons that all code for the…
Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA? Because it is entropically unfavorable Because that would cause a steric clash between the sugars and nucleobases Because that would cause a steric clash between the 2' OHs of the sugars and the phosphates Because uracil can't form hydrogen bonds with any other nucleobases
Which of the following mRNA codons could be changed to a stop codon by a single base pair substitution in DNA ? [In other words, if you substitute one of the bases for a diferent one, it will produce a stop codon. Don't overthink this. Just look at the codon as written, and see if changing any one base leads to a stop codon]. 1. UAC (tyrosine) 2. UGG (tryptophan) 3. CGA (arginine) 4. ACU (threonine) A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct
Suppose the coding (sense) strand of some DNA has this base sequence: 5'- ATATGTGG-3' Write the base sequence of the mRNA that would result from transcription of this DNA. 5' 3' X
A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon?
can someone help
Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. Use the table and write the sequence of the resulting peptide. Is it possible for a codon to code for another amino acid? What will be the effect if a mutation changes the codon UAU to UAA? What is a reading frame? If you are given a nucleotide sequence, how would you find Open Reading Frames? DISCUSS the reason why there are leading and lagging strands in replication?
State the direction of movement of the ribosome along the mRNA strand (the direction of translation). 5’ to 3’