A gene encodes a protein with the following amino acid sequence: Met-Trp-His-Arg-Ala-Ser-Phe A mutation occurs in the gene. The mutant protein has the following amino acid sequence: Met-Trp-His-Ser-Ala-Ser-Phe An intragenic suppressor mutation restores the amino acid sequence to that of the original protein: Met-Trp-His-Arg-Ala-Ser-Phe Give at least one example of base changes that could produce the original mutation and the intragenic suppressor.

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: A gene contains 30% thymine. What is the percentage of pyrimidines present in this segment? Explain.

A: Purines and pyrimidines are chemical molecules that play a role in the production of DNA and RNA and…

Q: Sickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid…

A: Introduction : Haemoglobin is a tetrameric proteinmade up of 2 alpha subunits and 2 beta subunits…

Q: With this gene provided: MuPKS c.1949 C>T (p.R644W) Please provide the following; 1. Name of the…

A: The DNA is formed of two nucleotide chains joined through a hydrogen bond formed between the…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an…

A: Mutation It is defined as the alteration in the sequence of DNA due to the exposure to some mutagens…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: type of mutation

A: If the sequence was mutated from CACGTAAAG to become CACCGTAAAG; single nucleotide insertion…

Q: A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same…

A: Introduction: The chain of amino acids is known as a peptide which is connected by an amine or…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…

A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: How many of the mutations listed below would lead to excessive cell growth when the cell was either…

A: Excessive growth occurs when a cell continuously divides and when there is no cell cycle arrest. Myc…

Q: Define FOUR (4) types of point mutations within coding sequences

A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…

Q: A) Tet-Off B) Tet-On rRTA ITA TRE Target Transgone TRE Target Transgene +Dox +Tc or +Dox tTA ETA TRE…

A: as the diagram shows the tet-on and tet-off system

Q: Based on the following wild type sequence, indicate if each of the mutations should be classified as…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: Describe the mutation that occurs in the following examples (be specific, if possible): BOAT  to BAT…

A: Mutations are changes or alterations or modifications in the nucleotide sequence of the genome or…

Q: hutations in a structural gene (coding for a protein) have a null phenotype. How many different…

A: Nonsense mutations : It is a genetic mutation in a DNA sequence that results in a shorter ,…

Q: define the term name as Missense mutations

A: sometimes a wrong nucleotide will be incorporated in the DNA. that can result in a type of mutation…

Q: The following is a polypeptide from a wild type organism: met – ser – tyr – his – trp – arg – ser –…

A: Mutation is any sudden change resulting in an abnormal structure.  The given polypeptide chain is,…

Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…

A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…

Q: The following enzyme has an exact integer number of turns. What is the length and amount of amino…

A: Enzyme are usually composed of proteins while some enzymes are ribozymes (RNA enzymes). Proteins are…

Q: three different types of loss of function mutations and in each case explain how the mutation exerts…

A: A mutation is any alteration of the base sequence of the DNA or RNA. Since mutation alters the base…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr.…

A: The translation is a process where a mature mRNA sequence is converted into respective amino acids…

Q: Identify the following mutations and describe what the possible effect on the protein will be. (4)…

A: Mutation in general refers to the change in one or more gene. Some are negligible while others can…

Q: The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation…

A: sickle cell anaemia is caused by inherited abnormal hemoglobin that causes the sickling of red blood…

Q: In Figure 6-1,a. what do the yellow stars represent?b. explain in your own words why the…

A: Each gene has two copies, also known as alleles, where each allele contributes 50% to the protein…

Q: If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu…

A: Introduction  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: A missense mutation is a single base pair change that Results in no amino acid change Results in one…

A: In genetics, a missense mutation is a point change in which a solitary nucleotide change brings…

Q: Which of the following would be most likely to be a conservative or mild mutation? Histidine (His)…

A: Also known as conservative replacement or conservative substitution as it involves amino acid…

Q: What is a transposon? Explain why the insertion of a transposon into the DNA of a cell can lead to a…

A: Transposons are also known as jumping genes and are mobile genetic elements. They can reshuffle the…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?

A: m-rna is synthesized in 5' to 3' direction and it used the enzyme rna polymerase and dna template…

Q: G-LO37 Identify the consequences of mutations in different regions of a gene. The image below…

A: A mutation is a change to an organism's DNA sequence. Errors in DNA replication during cell…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.