7. How many hydrogen bonds exist between this DNA strand and its complementary strand? •5'-GAGAGTC-3'

Q: 8. DNA basic structure: Below, I have drawn a representation of a single strand of DNA. Draw a…

A: The self replicating molecules that are present in the chromosomes and carry genetic information are…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: You perform the following solid-phase oligonucleotide synthesis: DMT lodine, water, pyridine DMT-O…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: What would happen if we take out a nucleotide (frameshift)? Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-T…

A: ACCORDING TO THE CENTRAL DOGMA, DNA IS TRANSLATED TO mRNA WHICH GETS TRANSLATED TO PROTEINS. THE…

Q: 10. A replication bubble is shown below, with the origin of replication represented by a black dot.

A: In this question, we have to answer about the process of replication.

Q: 5’ - A T G    G C C    C A A    C T G    A C C - 3’ a. How many nucleotides are listed here b. How…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: To maintain uniform diameter of the DNA double helix, only purines base with each other via two…

A: DNA is the fundamental structure that carries all the information of a living thing. In most cases,…

Q: 1. Draw an accurate segment of DNA with its complimentary strand. (10 points) Make sure to include…

A: DNA (Deoxyribose :Only acts as genetic material.Polynucleotide (monomeric unit is…

Q: 4 bases that make up DNA

A: A base pair consists of two complementary DNA nucleotide bases that pair together to form a rung of…

Q: 10

A: DNA replication is a process by which new copy of DNA molecules are made by DNA polymerase.

Q: On the diagram of this DNA molecule, match the letters to the corresponding components: (should only…

A: In the diagram below DNA is shown. DNA is made up of a monomer called nucleotide. Each nucleotide…

Q: On the lagging strand, the carbon in position on the deoxyribose sugar is facing the helicase enzyme…

A: *DNA replication occurs in  semiconservative manner . * Each strand in the double helix of DNA  acts…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

Q: prateins OP (weak bonds) a better source of energy than H,O (strong bonds)? 37. What is the…

A: Since you have asked multiple questions, we will solve the first complete question for you. If you…

Q: 1. Complete the structure of this section of a DNA molecule. Label each base (A.I,G,C), sugar (S)…

A:

Q: Daughter strand 5' end 5-CH₂ CH₂ s s s OH CH₂ 3′ ÓH TE 3' end 3' end T OH 3 H₂C H₂C H₂C 5' end…

A: The question is asking about the direction of growth of the daughter strand during a synthesis…

Q: abel the diagram by dragging the labels to the appropriate targets. DNA's secondary hydrophobic…

A: DNA or deoxyribonucleic acid contains the hereditary units called "genes" that carry information…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: DNA stands for deoxyribonucleic acid. It is made up of nitrogenous bases (ATGC), deoxyribose sugar…

Q: 7.) Give the base sequence of the complementary strand of DNA in this molecule. Label the 5' and 3'…

A: DNA is also called as Deoxyribonucleic acid which is an polymer composed of two polynucleotide…

Q: What is the Complimentary DNA Strand to CGTCAGCAGACGAAAGGGCTTGCGGCGCGC. What is the content of CG in…

A: To find the complementary DNA (cDNA) strand, we need to identify the base pairs for each nucleotide…

Q: Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing…

A: Basic structure of DNA and the structure of different nitrogenous bases.

Q: 4. If your nucleotide sequence is - Is this sequence DNA or RNA? Explain how you know. - What would…

A: To determine the complementary strand of a DNA sequence we need to understand the base-pairing rules…

Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…

Q: 15. A strand of DNA has the nucleotide sequence shown below. Underneath it, indicate the sequence of…

A: Introduction :- Because of the nature of complementary base pairing, if we know the sequence of one…

Q:

A: Purines is equal to pyrimidines. So  A=T C=G

Q: if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the…

A: DNA or Deoxyribonucleic acid is the genetic material which passes from one generation to another.…

Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…

A: Double-stranded DNA consists of two polynucleotide chains each strand having a phosphodiester…

Q: a.Write out the complementary strand to the following sequence. Begin with the 5' of the end of the…

A: The Nucleotides polymers that are responsible for determining and regulating the genetic…

Q: Demonstrate your understanding of DNA structure by circling the specific segment on the DNA double…

A: There are two types of nucleic acids present in our body, DNA and RNA. DNA acts as a genetic…

Q: 5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the…

A: Transcription is the synthesis of RNA and translation is the synthesis of proteins. There is a…

Q: 8. Which of the following diagrams best illustrates a DNA molecule? R R R CH, O H H3C CH3 H CH, O ||…

A: Genetics is the branch of biology that deals with genetic material like DNA, RNA, inheritance.…

Q: Given is a strand of DNA, fill in the corresponding RNA strand and find which amino acids that…

A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.