62. Which of the following represents the sequence of the template strand?" A. 5'--GAAGACTAACATTCA--3' B. 5'-- ACTTACAATGTAGUA--3' C. 5'-- CTTCTGATTGTAAGT--3' D. 5'--ACTTACAATCAGAAG--3' E. 5'--TGAATGTTAGTCTTC--3'

Q: 18)(recall) RNA polymerase moves along the template strand of DNA in the DIRECTION, and adds…

A: As per the guidelines we are supposed to answer only the first question, in case of multiple…

Q: From the previous question regarding the insertion of an A base into the template strand: will this…

A: The transcription is the process of RNA synthesis from the DNA template. It is the first step of…

Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: continuous sequence Explain the statement. of - base

A: The sequence of bases in a portion of a DNA molecule , is called gene . It carries the instructions…

Q: Why is it important to restore displaced histones to the DNA following transcription? A) to reform…

A: The process of transcribing information from a strand of DNA into a new messenger RNA molecule is…

Q: How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect…

A: Before an answer is given, the process of DNA replication must be understood. First there are two…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: 5' 3' ORF1 ORF2 ORF3 ORF4 ORF5 1. Above are pictured 2 operons, one that includes ORF1 and OFR2 and…

A: The production of RNA from DNA is known as transcription that occurs within the cytoplasm of…

Q: 5" i) RNA iv) POLYMERASE RNA-DNA hybrid region NTPs v) X Nucleotide being added to the vi) end of…

A: The image describes transcription. Transcription is a process in which RNA polymerase  helps in the…

Q: (d) Would there be an effect on translation of changing the fourth A in the template strand to a C?…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…

A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…

Q: 93. Which is a common function for the protein product of a cancer-causing gene? a) a role in DNA…

A: Cancer-causing genes, like the name implies are genes that lead to the development of cancer. We…

Q: Sequencing of the following fragment of single-stranded DNA needs to be undertaken using the Sanger…

A: Sanger sequencing, also referred to as the “chain termination method”, may be a method for…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: The sequence of a fragment of one strand of DNA is ACCGTCCATCGCATA. Transcribe this sequence into…

A: Introduction :- Transcription is the process of synthesizing RNA from a DNA template. During…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: Based on one strand of a certain segment of DNA with the sequence below, answer the following…

A: DNA and RNA are major bio molecules found in the body. They help in transferring the information…

Q: The following sequence is a double stranded DNA.…

A: The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene…

Q: Which repeating sequence below would you expect to find on the end of the longest DNA strand of a…

A: Telomeres are nucleotide sequences found at the ends of linear chromosomes. They consist of…

Q: Explain why the following statement is true: RNA polymerase copies template DNA in the 3’ to 5’…

A: The DNA helix is unwound right before the active site for polymerization by the RNA polymerase,…

Q: A 5' -I D.

A: DNA replication is that the method by that a double-stranded deoxyribonucleic acid molecule is…

Q: 25. Which sequence includes RNA that's complementary to the DNA sequence 5'-TATTCGC-3'? (Hint: in…

A: Adenine(A) and guanine(G) are purines ; cytosine(C) and thymine(T)/uracil(U) are pyrimidines , both…

Q: 28. What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′…

A:

Q: particular triplet of bases in the template strand of DNA is SAGT- What would be the corresponding…

A:

Q: 25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are the DNA digesting enzymes.

Q: 5' Figure 2 below is a schematic diagram illustrating a short gene with 5000 bp of an unknown…

A: Transcription is defined as a process in which a transcript (RNA) is formed.  It is a unidirectional…

Q: A certain section of the coding (sense) strand of some DNA looks like this: SATGTATATCTCCAGTTAG-3…

A: Alternation of DNA sequence or any other charge in the chromosome shape or number is considered as a…

Q: .  Locate the -10 region hexanucleotide sequence in the following coding strand of DNA.  Indicate…

A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…

Q: Is each of the following mutations a transition, transversion, addition,or deletion? The original…

A: Since no specific subparts have been asked to be answered, the first three subparts have been…

Q: Which DNA repair systems you think might be capable of repairing a situation where T is in one…

A: DNA repair is a process by which a cell identifies and corrects damage to the DNA molecules. Most…

Q: 90. The DNA template fragment shown was sequenced by the Sanger method. A sample of the DNA was…

A:

Q: What happens during the TERMINATION step of transcription? A. base pairs are added to the mRNA…

A: Transcription is a process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: Pyrimidine dimers in DNA may be repaired by in E. coli cells. (select all correct answers) Select…

A: The most well-known DNA lesion involving a single DNA strand is pyrimidine dimer. It is an…

Q: 1. Cytosine deamination, in which cytosine is mutated to uracil, occurs spontaneously in DNA at a…

A: Nitrogenous bases are cyclic compounds that contain nitrogen. They can be: Purines are heterocyclic…

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction :  One of the earliest steps in gene expression is transcription. The transfer of…

Q: if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the…

A: DNA or Deoxyribonucleic acid is the genetic material which passes from one generation to another.…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…

Q: Identify the type of point mutation on the following strands (transition or transversion):  a. 5’…

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Q: 17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: 47 If base #6 is changed from A to T, what type of mutation is this?? ANTISENSE STRAND 5' ATTTGACGG…

A: Antisense strand is also known as template strand. This strand is used to produce mRNA during…

Q: SPOI.

A: The principle cytotoxic lesion for radio-mimetic chemicals and…

Q: Which primer would bind to this coding strand as a reverse primer? 5' - ATGGCCAAAT GATTCCCACG…

A: Primers are very short sequences of nucleotides (usually 18 to 22 nucleotides) that play an…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.