6. Lovastatin (see picture), is a potent competitive inhibitor of HMG-COA reductase (B-hydroxy- B-methylglutaryl-COA reductase). In addition, the synthetic compound, Terbinafine (see picture), is a potent inhibitor of squalene monooxygenase. Both compounds could be used to treat hypercholesterolemia, a genetic disorder where the patient synthesizes too much cholesterol regardless of dietary intake of cholesterol. a. Predict and explain the effect of these drug on serum cholesterol levels in humans. b. Based on squalene monooxygenase's role in synthesizing sterols, explain why terbinafine is marketed as an anti-fungal agent, and not for hypercholesterolemia. но COO Lovastatin OH на R, CH „CH3 Terbinafine R2 н,с

6. Lovastatin (see picture), is a potent competitive inhibitor of HMG-COA reductase (B-hydroxy- B-methylglutaryl-COA reductase). In addition, the synthetic compound, Terbinafine (see picture), is a potent inhibitor of squalene monooxygenase. Both compounds could be used to treat hypercholesterolemia, a genetic disorder where the patient synthesizes too much cholesterol regardless of dietary intake of cholesterol. a. Predict and explain the effect of these drug on serum cholesterol levels in humans. b. Based on squalene monooxygenase's role in synthesizing sterols, explain why terbinafine is marketed as an anti-fungal agent, and not for hypercholesterolemia. но COO Lovastatin OH на R, CH „CH3 Terbinafine R2 н,с

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

1 10 5' АGT ССG A UGC 3' 8. There are inaccuracies in the DNA molecule shown here. || | | | | |||| 5 тCА GGCT АТG 3' a) Name three things that are wrong in the above DNA sequence. b) What type of chemical interaction is indicated by a "|" in the diagram? c) What happens to these interactions during DNA replication?
Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Removes RNA primer and replaces it with newly synthesized DNA. [ Select ]
smolA eno DNA -- THE DOUBLE HELIX (modified from The Biology Corner - Worksheets and Lessons) The nucleus is a small spherical, dense body in a cell. It is called the "control center" because it controls all the activities of the cell. Chromosomes, found in the nucleus, are microscopic, threadlike strands composed of the chemical DNA (short for deoxyribonucleic acid). Chromosomes are composed of genes, which is a segment of DNA that codes for a particular protein which in turn codes for a trait. It is commonly referred to as the gene for baldness or the gene for blue eyes. In 1953, James Watson and Francis Crick established the structure of DNA. The shape of DNA is a double helix, which is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. Color all the phosphates red (labeled with a "p"). Color all the deoxyriboses blue (labeled with a "D"). The rungs of the ladder are pairs of 4 types of nitrogen bases. The…
5' carbon = 3' carbon = hydrogen bond = phosphodiester bond = phosphate group = deoxyribose sugar = nitrogenous base =
Answer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتب
why 3 methyl histidine is used to measure muscle mass?
Which positions can tolerate conservative substitution?
3 attempts left Check my work Be sure to answer all parts. Re Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CCC to CCA in DNA, what dipeptide is formed? Gu c. If a mutation converts CCC to CGC in DNA, what dipeptide is formed? d. If a mutation converts CCC to GCC in DNA, what dipeptide is formed? a. b. c. d.
During in vitro synthesis of DNA, a reasercher used 2',3'-didoxy cytidine triphosphate as raw neclutide in place of 2'deoxy cytidine.what woulb be consider?
Not satisfied with the previous solution so posting again
Write down the complement strand of DNA for the following sequence and place the 3' and 5' on the appropriate ends. 3' - GGGCCTAATATAGCTTTACGGTAT - 5'
1 2 3 "0-P 0 "0-P=0 "0-P=0 "0-P=0 "0-P=0 "0-P=0 "0-P=0 0-P=0 "0-P=0 Base Base Base CH, CH, CH2 H H H H H H H H H. H. OH H H H но но