57. You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps. You obtain a sampleof these bacteria and perform the same kind of experiment that Meselson and Stahl did to determine howthe Mars bacteria replicate their DNA. Based on the following equilibrium density gradient centrifugationresults, what type of replication would you propose for these new bacteria?band position280608 8before after 1stN₁4after 2ndreplication replicationA)conservativeB) semiconservativedispersiveC)D) semiconservative or dispersiveE) conservative or dispersiveafter 3rdreplication

Replication is the process in which a daughter strand of DNA is synthesized from its parental…

57. You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps You obtain a sample the Mars bacteria replicate their DNA. Based on the following equilibrium density gradient centrifugation of these bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how results, what type of replication would you propose for these new bacteria? band position A) 28060 D) 8 88 before after 1st after 2nd after 3rd replication replication replication N₁ conservative semiconservative dispersive semiconservative or dispersive consery

57. You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps You obtain a sample the Mars bacteria replicate their DNA. Based on the following equilibrium density gradient centrifugation of these bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how results, what type of replication would you propose for these new bacteria? band position A) 28060 D) 8 88 before after 1st after 2nd after 3rd replication replication replication N₁ conservative semiconservative dispersive semiconservative or dispersive consery

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter22: Prokaryotes: Bacteria And Archaea

Section: Chapter Questions

Problem 35CTQ: A scientist isolates a new species of prokaryote He notes that the specimen is a bacillus with a...

See similar textbooks

Similar questions

Calculate the number of times the DNA of a modern E. coli cell has beencopied accurately since its earliest bacterial precursor cell arose about 3.5billion years ago. Assume for simplicity that over this time period, E. coli hasundergone, on average, one cell division every 12 hours (this is anoverestimate for modern bacteria, but probably an underestimate for ancientbacteria).
Suppose Meselson and Stahl had done theirexperiment the other way around, starting with cells fully labeledwith 14N light DNA and then transferring them to mediumcontaining only 15N heavy DNA. What density of DNA moleculewould you predict after one and two rounds of replication?
Since DNA is a hydrophillicmoelcule, it cannot pass through cell membranes. Name and explain the technique with which the DNA is forced into (ii) a bacterial cell (ii) a plant cell (iii) an animal cell.
You wish to produce a high-value protein using recombinant DNA technology. Would you try to develop a chemical defined medium or a complex medium? Why? Explain what semiconservative replication means. Give characteristic dimensions for each of these organisms: E. coli Yeast (S. cerevisiae) Liver cell (hepatocyte) Plant cell .What are the differences in cell envelope structure between gram-negative and gram-positive bacteria? These differences become important if you wish to genetically engineer bacteria to excrete proteins into the extracellular fluid.
A scientist isolates a new species of prokaryote He notes that the specimen is a bacillus with a lipid bilayer and cell wall that stains positive for peptidoglycan. Its circular chromosome replicates from a single origin of replication. Is the specimen most likely an Archaea, a Gram-positive bacterium, or a Gram-negative bacterium? How do you know?
A segment of DNA has the following sequence:TTGGATGCTGAACCTACGACA. What would the sequence be immediately after reaction withnitrous acid? Let the letters H represent hypoxanthine and Urepresent uracil.B. Let’s suppose this DNA was reacted with nitrous acid. Thenitrous acid was then removed, and the DNA was replicated fortwo generations. What would be the sequences of the DNAproducts after the DNA had replicated two times? (Note:Hypoxanthinepairs with cytosine.) Your answer should containthe sequences of four double helices.
28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…
A new, highly antibiotic resistant strain of bacteria contains a small, circular, segment of self-replicating extrachromosomal DNA. Which of the following apply? O The bacterial species has an endospore O The bacterial species has an acid fast cell wall O The bacterial species has a plasmid The bacterial species has a flagellum O The bacteria has a capsule
You do a PCR reaction,run a sample of the product on a gel,and use a dye to visualize the bands. Youexpect a single product of 300 bp, whichyou observe, but you also see a band ofabout 550 bp. Can you suggest a reasonwhy? Does the size of the unexpectedband indicate anything about your targetsequence?
In the experiment of Mesel- Question 3 son and Stahl on DNA replication, if the cells are cultured for many generations in a medium containing heavy nitrogen (N 15) and thereafter transferred to a medium containing only light nitrogen (N 14), what percentage of double- stranded DNA is composed of two heavy chains after one generation? A 25 B 75 C 0 D 50 E 100
In an experiment, you grow bacterial cells for several generations in the presence of a light isotope of carbon (C¹2) and then transfer them into a medium containing a heavy isotope of carbon (C¹³). After one round of DNA replication, which of the following statements is true? O All DNA molecules will be labeled entirely with C¹3 ● For all DNA molecules, each strand will be labeled with a mixture of C¹2 and C¹³. Half the DNA molecules will be labeled with C¹2 only, whereas the other half will be labeled with C¹3 only. O All DNA molecules will be labeled entirely with C¹2 O For all DNA molecules, one strand will be entirely labeled with C¹2, whereas the other strand will be entirely labeled with C¹3 O Insufficient information to conclude.
Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in cultures of E. coli and equilibrium density gradient centrifugation. Draw pictures to represent the bands produced by bacterial DNA in the centrifuge tube before the switch to medium containing 14N and after one, two, and three rounds of replication in that medium. Use separate sets of drawings to show the bands that would appear if replication were (a) semiconservative; (b) conservative; (c) dispersive.