Suppose there are three tubes containing following samples in the laboratory. The three tubes are unlabeled and are shuffled. How will you identify DNA, RNA and Protein containing tube with naked eye? Support your answer with proper reason. DNA RN Protei 1 A2 n3

Suppose there are three tubes containing following samples in the laboratory. The three tubes are unlabeled and are shuffled. How will you identify DNA, RNA and Protein containing tube with naked eye? Support your answer with proper reason. DNA RN Protei 1 A2 n3

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: In one paragraph, using your own words, describe the structure of DNA. Be sure to include the…

A: Introduction :- DNA, or deoxyribonucleic acid, is a long, double-stranded molecule that contains the…

Q: For a DNA sequence 5'-CTAAGCCGGAT-3', what is the complementary DNA sequence? Question 6…

A: DNA or Deoxyribonucleic acid serves as the hereditary material of almost all living entities (some…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…

Q: DNA Fingerprints Cat Kittens IL || ILL || I I

A: DNA fingerprinting is a technique used to compare sequences in genomes using satellite DNAs like…

Q: True or False, if the statement is false, provide the correct answer. 1. The amino acid sequence is…

A: Introduction Photosynthesis is the process by which plants transform CO2 absorbed from the…

Q: A DNA fragment with 450 bp will be closer to the top (negative pole) of an electrophoresis gel than…

A: Friedrich Meischer discovered nucleic acids from the nuclei of pus cells and coined the term…

Q: Illustrate a short DNA segment showing the bonds formed between complementary base pairs as well…

A: Introduction: The two types of nucleic acids are RNA and DNA. The nucleic acid serves as a…

Q: Paternity Test: Alanna claims John is the father of Timmy, but Leo thinks that he is the father. All…

A: Paternity testing It involves the use of profiles of DNA to identify whether an individual is the…

Q: The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the…

A: chargaff's rule states that in DNA sequence in complementary strands the Adenine will form a bond…

Q: Which letter represents the following structures: (0.5X6) Okazaki fragment Replication fork Leading…

A: The given image is representing the process of DNA replication that occurs inside the cell before…

Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…

A: The DNA double helix has alternating major and minor grooves. The major groove is wider than the…

Q: Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify…

A: Note- according to our guild line we are supposed to answer only one question. Please repost the…

Q: Shown below is a double stranded DNA molecule.Replicate this DNA and show the products formed from…

A: DNA REPLICATION :- It is the process by which DNA makes a copy of itself during cell division. The…

Q: In DNA replication, the nucleotides used during PCR __________ compared to the nucleotides used…

A: Polymerase chain reaction PCR, which is a laboratory technique used to amplify a specific region of…

Q: You have 15 tubes, each containing 5 ul of DNA (each tube has a different DNA to cut). You want to…

A: A reaction mixture is a combination of 2 or more reactants in definite proportions to carry out a…

Q: Which would need to occur to replicate DNA? (select all that apply) Group of answer choices the…

A: DNA replication is the process by which the double-stranded DNA molecules replicate to produce…

Q: Can you please check my answer and make sure it is correct? Question: Why are hydrogen bonds so…

A: Hydrogen bonds are a type of attractive interaction between an electronegative atom and a hydrogen…

Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…

Q: In this gel, which letter (A, B, or C) indicates the largest piece of DNA in lane one? If the…

A: Gel Electrophoresis is a separation technique for the DNA fragments based upon their size. When the…

Q: What enzyme breaks the H-bond between nucleotides of DNA? Group of answer choices DNA gyrase DNA…

A: DNA is known as deoxyribonucleic acid. DNA act as the genetic material in most organisms present on…

Q: Which of these molecules links the most of the individual DNA nucleotides together on the newly…

A: ENZYME:- It is defined as a complex biological catalyst i.e produced by a living organisms in its…

Q: Which technique used to manipulate genetic material results in a significant increase in DNA or RNA…

A: In biotechnology laboratories different techniques are used to manipulate the genome of the…

Q: A circular double-stranded DNA molecule contains 4200 base pairs. Insolution, the molecule is in a…

A: The degree of super coiling in a DNA molecule is termed as supercoiling density. It is denoted by…

Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…

A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…

Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…

A: Replication is the process of synthesis of new strands of DNA from the parental DNA molecule and it…

Q: The following is the base sequence on the coding strand of a DNA molecule: AAT GCC AGT GGT TCG CAC…

A: A mutation in genetics is a change to a gene's DNA sequence. These alterations may happen naturally…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…

A: Answer

Q: A student has drawn an enlarged portion of a DNA “ladder” model to show two of the nucleotides in…

A: Nucleic acids consists of the genetic material which is found in all living organisms. The two most…

Q: complementary DNA sequence

A: Answer: Complementary sequence: Nucleic acid sequence of bases that can form a double- stranded…

Q: The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion…

A: DNA molecule is the genetic material present in the animals. Genetic material is present in the…

Q: Draw out the molecular structure of a double stranded DNA molecule. This molecule is 6 bp in size.…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: The sample furthest to the left contains the DNA size standards. What is the purpose of this sample?…

A: Gel electrophoresis is an analytical technique in which DNA fragments in a sample are separated…

Q: [References] Scoring: Your score will be based on the number of correct matches minus the number of…

A: The term double helix refers to the structure formed by double stranded molecules of nucleic acid…

Q: Each new double helix will contain ___________ strand of DNA from the parent strand and ____________…

A: The method of replicating a double-stranded DNA molecule into two identical DNA molecules is known…

Q: Show the replication strands in each of these bubbles (note they have different DNA orientations).…

A: DNA Replication Replication of DNA is a process of duplication of DNA, carried out by DNA…

Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB

Q: The following gel shows the results of a crime scene investigation. Lane 1 shows a DNA sample that…

A: Gel electrophoresis:- it is a technique used for the separation of Nucleic acids i.e. DNA and RNA as…

Q: lence: -T -G FG -A If RNA primase used this section of DNA to make a primer, what would be the…

A: RNA primase is an enzyme used in DNA replication. It produces RNA primer.

Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…

Q: DNA is visualized during agarose gel electrophoresis by ______________ . the fact that DNA…

A: Agarose gel electrophoresis is a process of separation of DNA on the basis of mass and charge of…

Question

5. Suppose there are three tubes containing following samples in the laboratory.
The three tubes are unlabeled and are shuffled. How will you identify DNA, RNA
and Protein containing tube with naked eye? Support your answer with proper
reason.
DNA
RN
Protei
1
A2
n3

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Give the DNA compliment to the following DNA strand. ATG UAC b. TAC GTG OMG
Determine the complementary DNA strand that would form. Next, write the mRNA that would form from each complementary DNA strand you created (normal and mutated). Remember that adenine in DNA matches with uracil in RNA, thymine in DNA matches with adenine in RNA, and guanine and cytosine go together. Normal DNA strand - CTG ACT CCT GAG GAG Mutated DNA strand - CTG ACT CCT GTG GAG
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
In the diagram below, identify the DNA by clicking on the correct highlighted portion. TACGGGCTA Lenovo
Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotide
A circular double-stranded DNA molecule contains 4700 base pairs. In solution the molecule is in a B-form helix, with about 10.6 base pairs per turn. The DNA circle has 12 superhelical turns. Calculate superhelix density
A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?
In a paragraph or two, summarize the structural organization of DNA. In your answer, be certain that you identify the chemical components of the molecule, and the arrangement of the molecule (the spatial properties). [You do not need to consider levels of packing of DNA into a cell.]
Since DNA anaylsis is specific to human body fluids such as blood, why do Crime Scene Investigators even bother with doing field test for biological fluids? Why not submit all samples that might have any kind biological fluid to the lab?
An enzyme to add nucleotides specifically at the ends of chromosomes would be: Question 6 options: Helicase Telomerase DNA polymerase DNA ligase
The genotype designation AA is called In DNA replication, the two new strands are called In DNA replication, the new, short, single segments of nucleotides produced by enzymes, that make up the new replicated strand, are called ________________. Two new DNA strands in replication are held together by a _______________. During DNA replication, when a nucleotide is lost, or an extra one added, if not genetically repaired, this condition is called a _________________.
True or false: Ethidium bromide is added to your hot liquid agar solution to help separate the DNA bands by size and overall charge. True False