47 The arrows indicate the products of a reciprocal translocation between chromosomes 9 and 22. Chromosome 22 derivative chromosome is shorter than its normal counterpart. Why? 7 10 12 自R as 66 13 14 15 16 17 18 19 20 21 22 Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a a gene segment is deleted A gene segment is transferred to chromosome 9 A gene segment is transferred to the homolog of chromosome 22 chromosome condensation has occurred

Q: to what do correspond respectively the grey, black and dotted lines? Indicate below the name of the…

A: Replication is the process by which the single mother strand helps to produce two daughter strands.…

Q: Based on these results, what can we claim? Select any/all that apply O There are at least 5 loci in…

A: In the provided Manhattan plot, regions with -log10(P) values exceeding 7 are considered…

Q: A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying…

A: The chromosomes have two arms that are called the short and long arm. The short arm is also referred…

Q: Can simple translocations ever be balanced? I know with reciprocal translocations that if you're…

A: Exchange of genetic information between different parts of the chromosome is called genetic…

Q: A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying…

A: Chromosomes are the large molecules of genes or DNA. The necessary information for every character…

Q: Identify the chromosome rearrangement that occurred between the two homologous chromosomes shown on…

A: Mutation:   Mutation refers to any change or alteration that occurs in the genetic material (DNA) of…

Q: What is the specific base sequence found in human telomeres, and how does the base sequence…

A: The physical end of the chromosomal is known as Telomere. It protects the chromosome's ends from DNA…

Q: ARVCS is a disorder characterized by the replacement of healthy heart tissue with fatty fibrous…

A: Mutation is any change in the nucleotide sequence of the gene. It may lead to disorders if it makes…

Q: Chromosomal Abnormalities Name of Number of Classification of Affected Description autosomes and…

A: A genetic disorder is an alteration in chromosomal number and their function. There are three types…

Q: Gene duplications are commonly observed in genomes of higher eukaryotes including humans. Which of…

A: The sequence of DNA or specific nucleotide sequence which is repeated multiple times within a genome…

Q: How would one best define the chromosomal location of a GENE? Select an answer and submit. For…

A: A. Located on a pair of homologous chromosome.

Q: With the given frequency, construct a chromosome map. Arrange the sequence correctly. Write the…

A: Step 1 A linkage or chromosome map is a linear graphic representation of the sequence of genes…

Q: A patient has abnormal expression of two genes at distant locations on the same chromosome. The…

A: Change in the DNA sequence or the number or structure of chromosomes is known as mutation. Mutations…

Q: A panel of cell lines was created by human–mouse somatic-cell hybridization. Each cell line was…

A: Somatic cell hybrids are culture lines that contain the entire complement of the mouse genome and a…

Q: Which of the following is described as a structural rearrangement of a chromosome in which a broken…

A: Chromosomal rearrangements consist of different events- deletion, duplication, inversion, and…

Q: The dominant condition elliptocytosis causes red blood cells to become misshapen into oval-shaped…

A: answer given below

Q: Draw a chromosome and a pair of homologs (or homolog pairs, or homologous chromosomes). Label on the…

A: Chromosomes are made up of proteins and DNA molecules. At the time of cell division they divides so…

Q: R. Alu 100 100 300 F ----- 100 100 Where would you expect to see a band or bands if you used PCR to…

A: 500 bp template was prepared by using amplified PCR with forward and reverse primers of 100 bp each…

Q: Group of answer choices Statement 1 is correct. Statement 2 is incorrect

A: Neurofibromatosis (NF) is a neurodegenerative disease that affects the brain, spinal cord, nerves,…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: Eukaryotic DNA is typically organized into two major regions called euchromatin and heterochromatin.…

A: Sol: Chromatin is a macro molecule which consist of DNA (deoxyribonucleic acid), RNA (ribonucleic…

Q: Review alternation of chromosome structure. Match the term and its description. Each term can only…

A: Chromosome is a thread like structure. It is a hereditary material transferred from parents to…

Q: In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field,…

A: Introduction Gel electrophoresis is a technique that uses size and charge to separate and analyse…

Q: An STR on chromosome 5 is very closely linked to a gene involved in a dominant metabolism disorder…

A: Gel electrophoresis is a technique that is used to separate DNA, RNA or proteins based on their…

Q: The homologous chromosome pairs in our cells do not carry identical sequences in all loci. This…

A: Proto-oncogenes are normal genes which affect normal cell growth and proliferation, but which have…

Q: The centromeric position of a chromosome can be represented by centromeric index (CI), which is…

A: The chromosome is the condensed form of DNA that contains all the genes. The chromosome is composed…

Q: The following gene arrangements in a particular chromosome are found in different geographic…

A: The mutation is a sudden and abrupt change in the structure and function of chromosomes.

Q: Here are the results of the testcross: Green-eyes, wild-type wings 245 Green-eyes, miniature wings…

A: 6) The number of flies with green eyes and and miniature wings are 232, these organisms are least in…

Q: Which of the following statements regarding gene duplication extra gene copies are highly…

A: Gene duplication is the process by which a region of DNA coding for a gene is copied. Gene…

Q: Please consider the figure below, parts A and B. A В 部 蹈器 Gene B Gene C Gene B Normal Gene A…

A: According to the question, two diagrams are given and few questions are asked. We have to solve the…

Q: how the exact location of the following gene in the chromosome. Draw and label.   2p32.1 2q42.2…

A: There are few important points : Chromosome : The DNA of a cell is present in a highly condensed…

Q: Chromosome 1 ABCDE FGH Original chromosome A BC CDE XF G Mutated chromosome Chromosome 2 B CD E GH…

A: Mutation can be understood as a sudden change in chromosome or alteration in genetic material which…

Q: Chromosomal rearrangement 1 Chromosomal rearrangement 2 centromere A1 B Chromosomal rearrangement 3…

A: In this exercise, we’re diving into the complex world of genetics, particularly centering on…

Q: A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying…

A: The thread-like structure found inside the nucleus of the cell is called a chromosome. It consists…

Q: Referring to Figure 17-19, draw a diagram showing theprocess whereby an inversion formed from…

A: Crossing over refers to the process of transferring genes between related chromosomes. Crossing over…

Q: One copy of chromosome 15 will be detected by FISH

A: Fluorescence in situ hybridization (FISH) is a laboratory technique for detecting and locating a…

Q: Eukaryotic chromosomes contain two general types of organization that relate to the degree of…

A: The production of RNA from DNA is known as transcription or gene expression. In eukaryotic cells…

Q: A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying…

A: Inversion is a type of chromosomal aberration. A part of the chromosome gets inverted 180°. The…

Q: What are G bands? Discuss how G bands are useful in the analysisof chromosome structure.

A: The band is defined as the chromosomal part that is easily distinguishable from adjacent segments by…

Q: Drag the terms to their matching descriptions to review characteristics of eukaryotic chromosomes.…

A: DNA:- Only acts as genetic material- Polynucleotide (monomeric unit is nucleotide)- Nucleotide is…

Q: A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying…

A: The thread-like structure found in the nucleus of the cell is called a chromosome. It consists of a…

Q: What is the name of the specific type of chromosomal abnormality present in the individual plant…

A: One or more of the following causes chromosomal abnormalities: Errors that occur during the division…

Genetic Variation

Genetic variation refers to the variation in the genome sequences between individual organisms of a species. Individual differences or population differences can both be referred to as genetic variations. It is primarily caused by mutation, but other factors such as genetic drift and sexual reproduction also play a major role.

Quantitative Genetics

Quantitative genetics is the part of genetics that deals with the continuous trait, where the expression of various genes influences the phenotypes. Thus genes are expressed together to produce a trait with continuous variability. This is unlike the classical traits or qualitative traits, where each trait is controlled by the expression of a single or very few genes to produce a discontinuous variation.