35. While modern blimps contain helium to create lift, the Hindenburg airship that famously caught fire and crashed on May 6, 1937 in flight from Germany to the United States was filled with 200,000,000 L of hydrogen gas. a. Assuming STP conditions, how many times less dense is hydrogen gas than helium gas? b. Given that many construction materials were quite heavy at the time, why might it have been advantageous to use hydrogen instead of helium in the airship? C. Based on your understanding of chemical reactivity and the periodic table, why is hydrogen a much more dangerous choice than helium for use in airships?

35. While modern blimps contain helium to create lift, the Hindenburg airship that famously caught fire and crashed on May 6, 1937 in flight from Germany to the United States was filled with 200,000,000 L of hydrogen gas. a. Assuming STP conditions, how many times less dense is hydrogen gas than helium gas? b. Given that many construction materials were quite heavy at the time, why might it have been advantageous to use hydrogen instead of helium in the airship? C. Based on your understanding of chemical reactivity and the periodic table, why is hydrogen a much more dangerous choice than helium for use in airships?

Chemistry

10th Edition

ISBN:9781305957404

Author:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Publisher:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Chapter1: Chemical Foundations

Section: Chapter Questions

Problem 1RQ: Define and explain the differences between the following terms. a. law and theory b. theory and...

See similar textbooks

Related questions

Q: Classify the type of lipid shown here. A) fatty acid B) steroid C) wax D) triglyceride

A: The three main types of lipids are phospholipids, sterols, and triacylglycerols (also known as…

Q: 17. Shown below is the generic structure of an amino acid. Amino acids undergo polymerization…

A: An organic compound that contains an alpha-COOH and alpha-NH2 functional groups is called amino…

Q: com X The folding of a protein is a complex and random process. Real Fake ê Abrir en Google…

A: A) Real The folding of a protein is a complex and random process

Q: QUESTION 55 The likelihood that the longer elution times (Rf) were due to the following: O The more…

A: As per our guidelines, I can answer only first question. Because you have posted multiple questions.…

Q: Define captopril ?

A: Captopril is a drug used to treat high blood pressure and congestive heart failure. Its IUPAC name…

Q: Q1) Define terms polymers, elastomers, and synthetic fiber. Also explain in detail the industries…

A: Solution - Polymers - A polymer is class of natural or synthetic substances which is made up of…

Q: Select the incorrect statement from the following option. A) Oils are saturated triglyceride B…

A: Saturated CompoundCompound contains only single bonds.Unsaturated CompoundCompound contains at least…

Q: What structural features make polymer to be thermo and thermosetting polymers? Explain with one…

Q: Most ring fusions in a steroid molecule are: Cis Parallel Trans Anti

A: Steroid molecules generally have a four fused cycloalkane rings. For example cholesterol.

Q: In polarimetry when lactic acid measured was contaminated with glycerol, what happens to the…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: 1. Draw 2D chemical representations of atactic, syndiotactic, and isotactic polystyrene. 2.…

A: First three question answered below:

Q: The monomers NH2 and HO-C (CH FOH would react with each other to form a polyamide a polycarbonate a…

Q: Is there commerical resin similar to RP-46 polyimide resin?

A: Ans: widely used thermoset polyimide resin comprises PMR-15 and RP-46

Q: 1-proteins-lab-manual?module_item_id=44333 A= abc Where "A" is absorbance, "a" is molar…

A: First question had been answered. Absorbance of a solution can be calculated using Beer Lambert law.

Q: At what pH will the following tripeptide have this structure? H2N-CH- -CH-C- N-CH-C-OH CH2 CH-OH CH2…

Q: acid) of the polymeric chains to produce large and narrow size porous structure, respectively.

Q: (k) dendrimer (1) engineering plastic (m) elastomer (n) end group (o) graft copolymer

A: A polymer is a large molecule composed of repeating units called monomers.

Q: + NaOCH₂

A: Robinson annulation: The given reaction is an example of Robinson's annulation reaction. In this…

Q: How many fused rings are there in steriod?

Q: What is the difference between dry and wet milling of starch? Which method is given more preference…

A: The dry milling and wet milling are important methods of processing. Distinct co-products are…

Q: Demonstration: the specimens shown are (a) a piece of cured epoxy resin, (b) a rubber band, and (c)…

A: Thermosets are polymers in which a cross-linking reaction which occurs. It promotes the chemical…

Q: new synthetic fibres in the last 15 years in the fibre industry? their chemistry their usuage

A: Synthetic fibres are fibres that are man-made through chemical processes. Some of its examples are…

Q: 2. a. Which amino acid is this? (might need to look at another amino acid b. Label which of these is…

Q: n one. Match enzyme or molecule with its function in bacteria. Answers may be used more than once or…

A: 37. RNA polymerase is the main enzyme in catalyzing DNA→ mRNA transcription. 38. DNA helicase…

Q: Pictured at left is the correctly filled Aufbau diagram for neutral calcium (AN = 20). What can you…

A: Afbau's principle shows the increasing energy of different orbitals. The filling of the electrons…

Q: what is pseudo order treatment

A: Pseudo is Latin word which means ‘fake’. A Pseudo order reaction can be defined as a bimolecular…

Q: Sketch the structure of a tripeptide composed of D-glucose, D-mannose, and D-galactose (in that…

A: Tripeptide are essentially consists of three amino acids which are linked together by forming to…

Q: High-density polyethylene (HDPE) fibre is used as liners for surgical gloves. Although the liner has…

Q: Hyaluronate in the cartilage acts as a: repeating unit of the aggrecan molecule. central filament…

A: Hyaluronate in the cartilage acts as a central filament between glycosaminoglycans It is present…

Q: Intermolecular chain transfer R R- MLn MLn P. R Intramolecular chain transfer Ring-Opening…

Q: Why can't chemical recycling–that is, the conversion of polymer to monomers and reconversion of…

A: In the preparation of low density polythene, very high pressure is required which is around 1000 to…

Q: Biological Macromolecules Identifying and drawing peptide bonds Draw the structure of…

A: If the pH is greater than pKa then deprotonation occurs and it exists in deprotonation form. While…

Q: Discuss the potential impact of polymorphism on the physicochemical properties of drugs.

A: The potential impact of polymorphism on the physicochemical properties of drugs are

Q: Which statement best explains the chemical differencesbetween DNA and RNA? (a) DNA has two different…

A: DNA and RNA are nucleic acids, that are important for the storage of genetic information and…

Q: The structure given below has what type of glycosidic linkage?

A: The carbonyl group of open-chain monosaccharides reacts with the hydroxy group of another carbon of…

Q: Which of the statement/s below is/are inaccurate? O a. Crosslinked polymers are stronger and have…

A: To state which of the given statements is/are inaccurate or incorrect:

Concept explainers

Mole Concept

Mole concept is a method to determine the amount of any substance that consists of some elemental particles using a grouping unit called ‘mole’. The mole concept enables one to handle the large amount of small elementary particles. The mole concept can be used in many calculations related to mole calculation, molar amount, mole ratio, and so on, which are significant in chemistry.

Question

Pls help ASAP.

35. While modern blimps contain helium to create lift, the Hindenburg airship that famously caught fire and crashed
on May 6, 1937 in flight from Germany to the United States was filled with 200,000,000L of hydrogen gas.
a. Assuming STP conditions, how many times less dense is hydrogen gas than helium gas?
b. Given that many construction materials were quite heavy at the time, why might it have been advantageous
to use hydrogen instead of helium in the airship?
C.
Based on your understanding of chemical reactivity and the periodic table, why is hydrogen a much more
dangerous choice than helium for use in airships?
d. Assuming STP conditions, how many moles of hydrogen gas were contained in the Hindenburg?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step 5

Trending now

This is a popular solution!

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

A³ 7. Which of the following is NOT true of a collagen helix or collagen? a) A collagen helix cannot contain prolines. b) A collagen helix has a special amino acid called Hyp c) Collagen is a fibrous protein d) In collagen three helices come together to form a triple helix 8. Which of the following CANNOT make a H-bond. More than one can be circled. a) N-HO=C b) N…H-O-H Ⓒ)C=O....N-C (d))C=OH-O- 9. Which of the following statements describes an apoenzyme? a) the place where a substrate binds b) an apoenzyme is an organic molecule that an enzyme needs to function correctly can apoenzyme is an enzyme that does not have its cofactor and therefore is not functioning it describes a theory on how substrates and enzymes interact.
DMATS1 OPP *H,N- *H;N-
see attached
Identifying and drawing peptide bonds V Draw the structure of serylarginine, a dipeptide made from serine and arginine, as it would appear at physiological pH. Explanation @ Click and drag to start drawing a structure. Check # $ * % MacBook Pro 80 & 0 X A :0 3 C © 2023 McGraw Hill LLC. All Rights Reser
Addition (chain-growth) polymerization reactions often terminate by combination or disproportionation. However, there is another class of deactivation reactions, called chain transfer reactions, which are usually relevant to the final degree of polymerization (dp). How might you expect the dp of a polymerization reaction deactivated by chain transfer compare/contrast with polymerizations terminated by combination or disproportionation?
The sequence of amino acids in a peptide chain is known as its _________ structure
Helppppppp I don’t get thisssss
It is identical repeat units along the chain. a. Random b. Alternating c. Block d. Graft
2D PtX2
22) please see attached
(asap
Which is the best season for wearing clothes made from synthetic fibres ?