3. In studying normal and mutant forms of a particularhuman enzyme, a geneticist came across a particularly interesting mutant form of the enzyme. Thenormal enzyme is 227 amino acids long, but themutant form was 312 amino acids long. The extra85 amino acids occurred as a block in the middleof the normal sequence. The inserted amino acidsdo not correspond in any way to the normal proteinsequence. What are possible explanations forthis phenomenon? How would you distinguishamong them?

3. In studying normal and mutant forms of a particularhuman enzyme, a geneticist came across a particularly interesting mutant form of the enzyme. Thenormal enzyme is 227 amino acids long, but themutant form was 312 amino acids long. The extra85 amino acids occurred as a block in the middleof the normal sequence. The inserted amino acidsdo not correspond in any way to the normal proteinsequence. What are possible explanations forthis phenomenon? How would you distinguishamong them?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
The earlier that two genes arose from a duplicated gene, themore their nucleotide sequences can have diverged, which mayresult in amino acid differences in the protein products. (a) Basedon that premise, identify which two genes are most divergentfrom each other. What is the percent amino acid identity betweentheir polypeptides? (b) Using the same approach, identify whichtwo globin genes are the most recently duplicated. What is thepercent identity between them?
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…
A genetics student was asked to draw the chemical structureof an adenine- and thymine-containing dinucleotide derivedfrom DNA. His answer is shown below. The student made morethan six major errors. One of them is circled, numbered 1, andexplained. Find five others. Circle them, number them 2 to 6, andbriefly explain each by following the attached given.
. A geneticist examined the amino acid sequence of aparticular protein in a variety of E. coli mutants. Theamino acid in position 40 in the normal enzyme isglycine. The following table shows the substitutionsthe geneticist found at amino acid position 40 in sixmutant forms of the enzyme.mutant 1 cysteinemutant 2 valinemutant 3 serinemutant 4 aspartic acidmutant 5 argininemutant 6 alanineDetermine the nature of the base substitution thatmust have occurred in the DNA in each case. Whichof these mutants would be capable of recombinationwith mutant 1 to form a wild-type gene?
a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four different bases. How many possible unique codons are there?b. If DNA had only two types of bases instead offour, how long would codons need to be to specify all20 amino acids?
1 ) A mutational event inserts one extra base pair into DNA. Which of the following outcome do you expect? no protein at all A B C D E protein in which only one amino acid is changed protein in which three amino acids are changed protein in which no amino acid is changed protein in which most amino acids after the site of insertion are changed
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
Do you think each of the following types of mutationswould have very severe effects, mild effects, or no effectat all?a. Nonsense mutations occurring in the sequences encoding amino acids near the N terminus of the proteinb. Nonsense mutations occurring in the sequences encoding amino acids near the C terminus of the proteinc. Frameshift mutations occurring in the sequences encoding amino acids near the N terminus of the protein d. Frameshift mutations occurring in the sequencesencoding amino acids near the C terminus of theproteine. Silent mutationsf. Conservative missense mutationsg. Nonconservative missense mutations affecting theactive site of the proteinh. Nonconservative missense mutations not in the active site of the protein