Answered: 3. In a well written paragraph, please…

Science

Biology

3. In a well written paragraph, please explain the relationship between mutation, the cell cycle, and cancer.

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter1: Invitation To Biology

Section: Chapter Questions

Problem 5CT: In 2005, researcher Woo-suk Hwang reported that he had made immortal stem cells from human patients....

See similar textbooks

Related questions

Q: 3) Draw a diagram of the cell cycle (G1, S..) and indicate places where errors in cell division…

A: Cell cycle It refers to a series of events that takes place in a cell leading to the growth,…

Q: 8. Select the statement that is FALSE: * O Some cells, like stem cells or skin cells, are constantly…

A: Mitosis is a type of cell division that occurs in somatic (non-sex) cells and results in two…

Q: 3. BPA is a chemical compound that was used in the manufacturing of plastic. When it comes into…

A: DISCLAIMER Since you have asked multiple questions, we will solve the first question for you. If you…

Q: 20. Describe three types of DNA repair that can occur in the cell. Name the three types and briefly…

A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA…

Q: Why is it important for mitosis to produce genetically identical daughter cells?

A: The cell division is responsible for the generation of daughter cells from the mother cell. Usually…

Q: What is the nature of genetic mutation of DNA repair proteins?

A: DNA repair is the process that repairs the lesions that occur in the DNA during replication and…

Q: labeled mitotic cells (%) 100- 75- 50 25 0 bod 0 5 10 15 20 25 30 time (hours) a) Would cells at all…

A: Introduction The cell cycle is the cascade of different events that leads to cell growth and…

Q: 5. Consider the process of transformation. Describe the process in terms of the cell that donates…

A: The technique of horizontal gene transfer known as bacterial transformation allows some bacteria to…

Q: Answer the questions below "in context", in 60 words minimum. A) Why is it important to understand…

A: A cell cycle is a progression of events that happens in a cell as it develops and partitions. A cell…

Q: 1.In which phase of the cell cycle are DNA mutations most likely to occur? A.S Phase B.G1 Phase…

A: Mutation - Mutation is defined as the sudden inheritable changes which occurs either in the…

Q: What are the advantages and disadvantages of mutation?

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Cancer results when a mutation leads to which of the following?

A: Cancer is a complex and multifaceted disease that can arise due to various factors, including…

Q: What genetic material was used in this research?" 2. How does the completion of this research…

A: Cancer: It is a diseases that occur due to the uncontrolled division of cells. When the normal cells…

Q: 2. Discuss the connection between cell division and cancer cells? How do cancer cells divide…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: 3. What might happen to a cell whose DNA is destroyed? What might happen to a cell whose DNA is…

A: Cell whose DNA is damaged- Every cell in our body's DNA is continually at risk of being damaged.…

Q: 7. Scientists studying the genetics of a congenital discase analyzed the chromosomes of the patient…

A: 7) This is Reciprocal translocation mutation. In this there occurs a balanced transfer of segment of…

Q: 3.Mention what are the important functions of apoptosis? discuss briefly at your own words?.

A: Apoptosis refers to the natural process of programmed cell death. It is a normal phenomenon which…

Q: 1. "What genetic material was used in this research?" 2. How does the completion of this research…

A: The uncontrolled growth and division of the cells lead to the formation of a mass or lump of cells…

Q: 17.What is something you found interesting about the connection between mitosis and cancer? Explain…

A: 17) Mitosis is the important cell division that takes place in our body. Mitosis is responsible for…

Q: 8. Molecules outside and inside the cell regulate the cellcycle, making it start or stop.a. What is…

A: Cells must signal each other to ensure the coordinated function of the body as a whole. These…

Q: describe

A: The differentiated cells are defined as the cells that are specialized during development as the…

Q: In what organelle of the cell does the process of DNA to mRNA take place?

A: Introduction All organisms are basically made up of cells, through the number, shape and types of…

Q: 1. Arrange the following structures from largest to smallest. • a chromosome • a nucleus • a gene…

A: The nucleus is an organelle found in eukaryotic cells. Inside its fully enclosed nuclear membrane,…

Q: 6. Consider the process of transduction. Describe the process in terms of the cell that donates the…

A: Bacteria reproduce asexually through a process called binary fission. Binary fission is a simple…

Q: 5. How does silent mutation affect protein production in the cell? Silent mutation A. changes the…

A: Introduction:- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: Discuss the stages or process of DNA and Cell replication. 2. What is DNA repair and discuss

A: DNA is a double stranded molecule which are linked together by hydrogen bonds. DNA replication means…

Q: 5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine…

A: In case of eukaryotic organism, cell containing nucleus, the cell cycle is categorized into two two…

Q: 4) Describe in detail how p53 and MDM2 regulate cell division in a normal, healthy cell. You should…

A: There are two proteins called MDM2 and p53 which plays an important role in regulation of cell…

Q: 3. A researcher discovered that a certain cell does not have any nucleosome modifiers What is the…

A: Nucleosome is made up of core of DNA wound around histone proteins. In order to perform various…

Q: 2. A researcher is studying the effects of a novel cancer drug on cell division and comparing the…

A: Cancer is an uncontrolled division of cell that has a defunct apoptosis mechanism. Usually, when…

Q: 2 A researcher is studying the effects of a novel cancer drug on cell division and comparing the new…

A: Cancer is a metabolic and genetic disorder characterized by uncontrolled cell division and tissue…

Q: Dylan Mortimer an artist struggled with Cystic fibrosis a disease causes the body to produce thick…

A: Cystic fibrosis is a progressive disease. Usually it can be detected in a person as early as first…

Q: It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of…

Q: 4. The diagram below shows cells in various phases of the cell cycle. Note the cells are not…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which…

Concept explainers

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase.

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons:

Question

100%

3. In a well written paragraph, please explain the relationship between mutation, the cell cycle, and cancer.
nish (Spain

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1.
37. Stem cells have the potential to be used in 3D printing to create specific geometries of specific tissues and organs True False
8. Select the statement that is FALSE: * O Some cells, like stem cells or skin cells, are constantly cycling, or progressing through the cell cycle. O Some cells, like newborn neurons, exit the cell cycle and enter GO, because they do not divide. O Some cells do not regularly divide but can be stimulated to divide by chemical signals called growth factors. Only some cells derive from a mitosis event.. A metastasis is : * A tumor that can grow indefinitely 1 pc The spread of calls from a tumor to a region of the body away from a primary tumor
In 2005, researcher Woo-suk Hwang reported that he had made immortal stem cells from human patients. His research was hailed as a breakthrough for people affected by degenerative diseases, because stem cells may be used to repair a persons own damaged tissues. Hwang published his results in a peer-reviewed journal. In 2006, the journal retracted his paper after other scientists discovered that Hwangs group had faked their data. Does the incident show that results of scientific studies cannot be trusted? Or does it confirm the usefulness of a scientific approach, because other scientists discovered and exposed the fraud?
1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine will be covalently incorporated into the cell's DNA during replication. The radioactive DNA can be detected in the nuclei of individual cells by autoradiography (i.e.. by placing a photographic film over the cells, radioactive cells will activate the film and show up as black dots when looked at under a microscope). During whatphase of the cell cycle will the radioactive thymidine be incorporated? Why?
1.create a Graphical Abstract to summarise the role of ALP in cancer?With image
1. Do you think it is possible to edit/modify ones genetic make up without adverse effects into the body? Will there be a time when we can customize our own or someone's genetic make up according to our preference? Why? 2. Discuss the connection between cell division and cancer cells? How do cancer cells divide indefinitely? Why do cancer cells kill normal cells of the body?
6. Consider an experiment in which cells are radioactively labeled by this method for only a short period of time (about 30 minutes). The radioactive thymidine medium is then replaced with medium containing unlabeled thymidine, and the cells are grown for some additional time. At different time points after replacement of the medium, cells are examined in a microscope. The fraction of cells in mitosis (which can be easily recognized because their chromosomes are condensed) that have radioactive DNA in their nuclei is then determined and plotted as a function of time after the labeling with radioactive thymidine. labeled mitotic cells (%) 100 75- 50 25 0 bod 0 5 10 15 20 25 30 time (hours) a) Would cells at all phases of the cell cycle contain radioactive DNA immediately after the labeling procedure? Why? b) Why are there initially no mitotic cells that contain radioactive DNA? c) Explain the rise and fall and then rise again of the curve. d) Estimate the length of G2 for these cells e)…
1.In which phase of the cell cycle are DNA mutations most likely to occur? A.S Phase B.G1 Phase C.G2 Phase D.Prophase 2.Which of the following contains all of the components of a nucleotide? A.Sugar, phosphate, base B.Sugar, amino acid, base C.Amino acid, phosphate, base D.Sugar, phosphate, amino acid 3.What is meant by the description “antiparallel” regarding the strands that make up DNA? A.The 5’ to 3’ direction of one strand runs counter to the 5’ to 3’ direction of the other strand. B.The twisting nature of DNA creates nonparallel strands. C.Base pairings create unequal spacing between the two DNA strands. D.One strand is positively charged and the other is negatively charged.
39. Stem cells transplanted from one person to another would havelessmedical complications. True False
3. What might happen to a cell whose DNA is destroyed? What might happen to a cell whose DNA is changed?