Answered: 26. Once a polypeptide chain has begun…

Name: site of the26. Once a polypeptide chain has begun growing during prot
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: site of the26. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying the next amino acid of the sequence will bond at theribosomal complex.a. АO b. Pс. 5'Od. 3'

Science

Biochemistry

26. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying the next amino acid of the sequence will bond at the ribosomal complex. site of the

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

#29 and #30
If a strand of mRNA contains the sequence, UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
…
A certain template DNA strand has the following nucleotide sequence: 3'—TACTGCATAATGATT—5' What would be the sequence of codons in the mRNA transcribed from this strand? What would be the nucleotide sequence of the complementary nontemplate DNA strand?
8) Explain translation from the perspective of an mRNA transcript.
1
51 23. Suppose that a mutation occurs in the DNA sequence (indicated by a red nucleotide). 5 ATG GGA CCC CAT TCC GCC AAG GGG CAC TGA 3' 3 TAC CCT GGG GTA AGG CGG TTC CCC GTG ACT 5' Type the RNA sequence that would be produced by this template: 3′
The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence of the DNA coding strand? Of the DNA template strand?
21. Answer and explain
For each amino acid added to a polypeptide which of the following must happen? a a charged tRNA must bind at the A site of a ribosome b a peptide bond must be made c the mRNA must move down three bases d all of the above
2
1)If we were to begin with protein that is 145 residues long, How many (ATP/GTP) would have to be used? (ATP hydrolysis from 1 pyrophosphate= 2 ATP)' 2)What is the corresponding codon of an anticodon GUA (ignoring the wobble).