Answered: 26. Once a polypeptide chain has begun…

Name: site of the26. Once a polypeptide chain has begun growing during prot
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: site of the26. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying the next amino acid of the sequence will bond at theribosomal complex.a. АO b. Pс. 5'Od. 3'

Science

Biochemistry

26. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying the next amino acid of the sequence will bond at the ribosomal complex. site of the

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

If a strand of mRNA contains the sequence, UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
38.
17. How would you computationally predict the thermodynamic stability of a long, extended RNA helix? Please explain in 1 sentence how structural "favorability" can be predicted
Charged tRNAS enter the ribosome in which site? A site E site O P site
51 23. Suppose that a mutation occurs in the DNA sequence (indicated by a red nucleotide). 5 ATG GGA CCC CAT TCC GCC AAG GGG CAC TGA 3' 3 TAC CCT GGG GTA AGG CGG TTC CCC GTG ACT 5' Type the RNA sequence that would be produced by this template: 3′
Describe the molecular structure of RNA & nitrogen-base pairing in mRNA.
The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence of the DNA coding strand? Of the DNA template strand?
II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. -GG CT |||||| -c C GATC G ACGAAGGAACCCCT- GGGGA- |||||
21. Answer and explain
Draw the stem-loop structure and the homodimer structure this RNA sequence (GGCCCUUUUCAGGGCC) can form. You have to show how each nucleotide is paired.
1)If we were to begin with protein that is 145 residues long, How many (ATP/GTP) would have to be used? (ATP hydrolysis from 1 pyrophosphate= 2 ATP)' 2)What is the corresponding codon of an anticodon GUA (ignoring the wobble).
Rank the steps of protein production in the order in which they occur. (1 = occurs first, 10 = occurs last) Initiation factors bind the small ribosomal subunit which recognizes the Shine Dalgarno sequence in the MRNA V[Choose] 6. 2 Elongation factors escort the aminoacyl 9. TRNA to the vacant A site of the ribosome 1 MRNA is spliced in the spliceosome to 10 remove introns 7 N-formylMethionine tRNA recognizes the start codon and recruits the large ribosomal [ Choose] subunit Translocation moves the uncharged tRNA to the E site and the recently extended tRNA is moved from the A site to the P site [ Choose ] DNA is transcribed into mRNA in the nucleus with the help of RNA polymerase [ Choose ] The newly formed polypeptide chain heads to the ER where it undergoes post- ( Choose] translational modifications Transcription factors bind DNA and help initiate the process of transcription [Choose ] Release factors recognize the stop codons and cause dissociation of the ribosome from ( Choose]