25. An RNA chain being synthesized grows in the direction. a. 5' to 3' Ob. 3' to 5' c. either direction d. no correct response is given

Q: 33. In TOF MRA, signals from tissues other than blood are eliminated by a. Digital subtraction…

A: According to the policy, answers can be provided only to one question at a time. To get answers to…

Q: 14. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: 14. An RNA strand that is complementary to specific regions of mRNA Group of answer choices 1.…

A: Thank you for the question : Answer :- the correct option is option 2 (Antisense RNA) Explanation :-…

Q: Which of the following is a significant difference between DNA and RNA? their main location in the…

A: Step 1 :- answer - No correct response   Deoxyribonucleic acid is a double stranded helical molecule…

Q: A double stranded region of RNA that can stall ribosomes is a(n) A. repressor sequence B. operator…

A: The RNA is produced from the DNA by transcription process and this RNA is used during the…

Q: Which of the following regions of the DNA is NOT transcribed by RNA polymerase? 1. -10/-35 promoter…

A: RNA polymerase is an enzyme that helps in the synthesis of RNA from the DNA template. This enzyme…

Q: 3. During transcription: A. nucleotides are polymerized by DNA polymerase B. initiation occurs at a…

A: Transcription is the process of synthesis of RNA (mRNA, tRNA, rRNA) from the DNA which can further…

Q: Retroviruses such as HIV, Herpesviruses, and Hepatitis B can be effectively inhibited by _____. Mark…

A: Nucleoside analogs such as acyclovir are antiviral drugs that can effectively inhibit the…

Q: mutation

A: Answer: Mutations in the promoter region resulted in a change in DNA binding pattern of the AP-2…

Q: 4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader…

A: We all know that Central dogma of life is a unidirectional flow of information from master copy DNA…

Q: It involves cutting out and replacing a damaged or inappropriate base or section of nucleotides…

A: The process by which two identical copies of DNA is obtained from a single DNA molecule is referred…

Q: 15. The RNA that has the lowest average molecular weight is O a. m-RNA b. r-RNA C. t-RNA d. they all…

A: In the total RNA these forms of rRNA tRNA and mRNA are present.

Q: A bacteria contains the gene for the lac operon, an enzyme that is produced in the presence of…

A: The lac operon is a fragment of DNA found in microscopic organisms that incorporates qualities…

Q: 1. Draw a schematic of a stretch of DNA (horizontally) in the space below to represent a gene a. Put…

A: DNA deoxyribonucleic acid is a genetic material in many organisms this genetic material inherited to…

Q: What is the sequence of the map with the following data: B-R is 4%; R-X is 8%; C-X is 4%; and B-X is…

A: Gene map is the most important tool for describing the distance between two gene, as well as overall…

Q: 5. Which end corresponds the last amino acid of a polypeptide chain? A. The 5' end of a DNA coding…

A: Proteins are made up of long chains of amino acids linked together by peptide bonds. The sequence of…

Q: Consider an image of an mRNA being translated. fMet GGG What was the sequence of the anticodon of…

A: Ribosome organizes the important process of translation ultimately catalyzing the reaction of…

Q: functional insulin required the association of two polypeptides known as the A and B chains…

A: Pre transcription control involves in DNA methylation.  Transcriptional control involves in…

Q: 7. Which of the following are RNA sequences? Check all that apply. Na promoter ferritin trp operator…

A: The question pertains to identifying which of the given options are RNA sequences. The options…

Q: A specific micro RNA is capable of destroying/degrade m-RNA after synthesis A. TRUE  B False

A: Introduction : The molecule RNA is crucial in translating the genetic code found in a cell's DNA…

Q: The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on…

A: A RNA  is produced by the process of transcription. Unit of transcription is called transcription.…

Q: OTPDI Ə g TITM d. The viral DNA will be rodioactive e. The viral proteins will be radioactive. 48.…

A: Introduction :-  Transfer RNA is an adapter molecule made up of RNA with a length of 76 to 90…

Q: State if each statement is true or false: a. Competent cells are bacterial cells that contain the…

A: All organisms are made up of cells. Cell are dignified as the basic building blocks of life. Cells…

Q: 21. Which of the following is NOT a function/ property of the Signal Recognition Particle  a.…

A: The Signal Recognition Particle (SRP) is a ribonucleoprotein complex and plays important roles in…

Q: Question on medicinal chemistry   Full answer please, will upvote straight away once read through

A: Bacteria are prokaryotic microorganisms. That is, bacteria are microorganisms which lack membrane…

Q: 1.a How does a cell recognize which strand is the sense strand? b. How does the RNA polymerase…

A: One of the important process in central dogma. It is a process of making a RNA copy using DNA; it is…

Q: 20. Initiation and elongation in translation requires         A ATP         B.TTP…

A: The translation is the process of protein synthesis in the cell. It takes place in the cytoplasm of…

Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…

A: Cells are composed of different components, cell organelles and molecules that are responsible for…

Q: 48. Which of the following is a definition of messenger RNA (mRNA)? a. RNA found in the ribosome,…

A: RNA stands for Ribonucleic Acid. It is the product of transcription. There are various RNA namely,…

Q: he RNA-induced silencing complex takes dsRNA and   a. Forms ssRNA that will target mRNA   b.…

A: The RNA-induced silencing complex (RISC) is a critical component of the RNA interference (RNAi)…

Q: Association for the Advancement of Science. Reprinted with permission from AAAS. FIGURE 6.13 16- 16…

A: RNA Folding and Unfolding: It's the process of a linear ribonucleic acid molecule acquiring…

Q: The point value of problems is given in braci number utilizes the enzyme a. Anticodon b. Polymerase…

A: Answers :- 1)RNA is synthesized on a DNA template in a process called transcription , which utilizes…

Q: Explain how RNA Pol II switches from strand initiation to strand elongation

A: RNA Polymerase II is a mulit-iprotein enzyme that transcribes DNA to messenger RNAs. RNA Pol II…

Q: 7. In the figure below, which label corresponds to the sequence that is responsible for the…

A: Transcription is the process of synthesis of mRNA from the DNA. After the transcription is over,…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: 12. Which lane or lanes on the gel could be the result of Mutation B?

A: The mutation is defined as the drafting change or sudden change in a sequence of nucleotides present…

Q: 3. [1] Proteins contain _different nucleotides: a. 20, 64 b. 3, 20, C. 4, 20 d. 20, 4 different…

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: 4. Use the RNA strand below and list the appropriate amino acids. AUG AGU UAC CCG GGA

A: Introduction :- Organic molecules known as amino acids have side chains unique to each amino acid as…

Q: Bacteriophage are very specific in the types of cells they can infect. Some see this as a possible…

A: A bacteriophage  also known informally as a phage  is a virus that infects and replicates within…

Q: 1. Activation of which transcription factor initiates the production of the antiviral type I IFNS? O…

A: The Central Dogma theory states that DNA makes DNA through Replication. DNA makes RNA through…

Q: Write out the complementary mRNA strand that would pair with the DNA: TACG GATCTAGA mRNA: Why do vou…

A: DNA or Deoxyribonucleic acid is a type of  Nucleic acid which act as Template for its own synthesis…

Q: plz explain with thorough explanation

A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…

Q: Briefly explain how the TRP operon can control the production of tryptophan.

A: A group of genes that are transcribe together to give a single mRNA molecule, which therefore encode…

Q: What do you call the site of activators that bind to the DNA molecule ? A. enhancer B. operon C.…

A: An important regulatory component in the regulation of gene expression is the location where…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.