16) The RNA dependent DNA enzyme: a. Is found in the mature hepatitis D virus. b. Is found in the mature hepatitis C virus. c. The end product of this enzyme is ssDNA d. This enzyme acts in the nucleus of the affected cell

Q: 71) For viral protein translation a. IRES is used in IBV to initiate the translation b. HA and A…

A: ANSWER;- d) The viral genomic protein found in the FMD virus is important to start the translation.…

Q: 69) in the first round of translation in Sheeppoxviruses the products are a. the proteins go back to…

A: * sheep pox also known as variola which is an  highly contagious disease of sheep due to a poxvirus…

Q: Although the specific mechanism of RNA interference has not been fully defined, it involves A. the…

A: The RNA interference works at the post transcriptional level because it occurs after the synthesis…

Q: 6a. C. elegans display a very characteristic sinusoidal movement, like a snake slithering. Imagine…

A: The movement of C. elegans, resembling a sinusoidal motion, is a distinct characteristic of these…

Q: 105) The Baltimore classification a. There were 4 classes for DNA families b. There were 6 classes…

A: Baltimore classification: It is based on the fact that the virus synthesizes mRNA for further…

Q: Retroviruses such as HIV, Herpesviruses, and Hepatitis B can be effectively inhibited by _____. Mark…

A: Nucleoside analogs such as acyclovir are antiviral drugs that can effectively inhibit the…

Q: A virus is isolated, and individual virions appear spherical. What type of virus is this? A.…

A: The essential construction or structure of a virus is comprised of a hereditary information molecule…

Q: biguitation lêdds to . Degradation of protein into amino cids =. Attack of ubiquinated protein by…

A: Ubiquitylation (sometimes called ubiquitination or ubiquitinylation) is an enzymatic…

Q: enzymes will form the m-RNA molecule?

A: The correct answer is option d). RNA polimerases II

Q: Prokaryotes are lacking. in their DNA sequence. A. introns B. exons. O C. promoter sites D. operons

A: Prokaryotes are the primitive type of cells that don't have membrane bound organelles and have the…

Q: 83) The RDRP of the rotavirus a. Only produced in the first round of translation b. It is…

A: RdRP- is RNA dependent RNA polymerase. All retroviruses have RNA dependent RNA polymerases.

Q: The picture below is the structure of a bacterial Nucleoid Associated Protein (NAP) associated with…

A: In bacterial cells, the genetic material is organized and compacted into a structure called the…

Q: ) The SARS-COV2

A: It is option c.

Q: Messenger RNA in eukaryotic cells is synthesized by which of the following enzymes (strongly…

A: Messenger RNA (mRNA) is a type of RNA molecule that carries genetic information from the DNA in the…

Q: 1. Your company plans to develop two monoclonal antibodies in mice against Spike (S) proteins of…

A: The current Covid-19 epidemic has increased interest in creating mAbs that focus on the virus' Spike…

Q: 100) The HA protein of Influenza vaccine is a. The HA1 is responsible for binding to unexposed…

A: Answer :- Option (B) is correct. - The HA protein of influenza vaccine is the HA protein of the…

Q: A mutation that eliminated the wild type function of PRE would be most consistent with... Select one…

A: Viruses that infect bacteria are known as bacteriophages. Phages have two life cycles: the lytic…

Q: The transcription factor that unwinds DNA to expose the template strand Group of answer choices

A: The conversion of DNA's genetic information into mRNA takes place by a process known as…

Q: The core RNA polymerase of E. coli cells may bind (select all correct answers) Select one or more:…

A: RNA polymerase(RNAP) is the core enzyme of gene expression and a target of regulation.In…

Q: Which of the following mutations is most likely?   a. Cytosine to Adenine   b. Guanine to Adenine…

A: When changes occur in our DNA sequence because of several reasons such mistakes while DNA copying…

Q: In prokaryotic cells, mRNA is translated as soon as it is transcribed because prokaryotes have...…

A: The  major difference between prokaryotic and eukaryotic cell is the  absence of membrane bound…

Q: A SNV mutation that results in no change in the amino acid sequence is called:  A. silent mutation…

A: A mutation is a permanent alteration in the DNA sequence of an organism's genome. DNA, or…

Q: A biologist develops a new drug that seems to dramatically slow the onset of symptoms resulting from…

A: HIV stands for Human Immunodeficiency Virus. It is a type of virus that attacks and weakens the…

Q: 1.   Transformation refers to .................................. Group of answer choices a.vertical…

A: Gene transfer: a. It is the mechanism by which DNA is transferred from a donor to a recipient cell.…

Q: The function of reverse transcriptase is toa. copy RNA into DNA.b. copy DNA into RNA.c. translate…

A: Retrovirus is a group of viruses that belong to the family Retroviridae and they have the RNA as…

Q: 98) The influenza virus is a. Segmented genome with a ds RNA b. Segmented genome with a negative…

A: Influenza virus is a member of orthomyxoviridae.

Q: prokaryotes, the origin of replication (oriC) possesses numerous A-T base pairs because it is easier…

A: The origin of replication (oriC) is the sequence in a genome where DNA replication begins. In both…

Q: A methyltransferase enzyme capable of methylating ribosomes and changing their structure might…

A: Introduction  Methyltransferase is an enzyme that transfers a methyl group from a donor molecule…

Q: The effect that allolactose has on LacI is a. causing it to block binding of the CAP protein. b.…

A: Operons are clusters of genes in prokaryotes which are under the regulation of the same promoter…

Q: The RNA polymerase that requires an input of energy to initiate the process of unwinding DNA is…

A: Eukaryotes consist of three types of transcribing enzymes, whereas prokaryotic cells contain only…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: Poliovirus contains a protein that possesses an NLS. A drug is developed that binds and hides this…

A: NLS or nuclear localization signal IA an amino acid sequence that tags a protein for import into the…

Q: Enzymes that have binding sites for modulators are specifically called a. zymogens b. quaternary…

A: An enzyme modulator can be defined as a substance that binds to a receptor to change the receptor's…

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.